Figure 1Body weight and body temperature changes in cotton rats inoculated with A/Solomon Islands/3/2007 virus. Four animals in each group were inoculated intranasally with 107 PFU of virus (A/Sol) and allantoic fluid (mock) and (A) body weights and (B) body temperatures were monitored.
Figure 2Representative histopathologic results in tissues from cotton rats inoculated with the A/Solomon Islands/3/2006 virus. Formalin-fixed lung sections were stained with hematoxylin and eosin (H&E). (A) Mock-infected cotton rat lung at 3 DPI. (B) Lung tissue at 1 DPI shows moderate peribronchiolar and interstitial inflammation that infiltrates the bronchiolar lumen. (C) Lung tissue at 3 DPI shows marked peribronchiolar, alveolar and interstitial inflammation. (D) Lung tissue at 7 DPI shows marked peribronchiolitis and resolution of alveoli. Sections are all at 100× magnification.
Figure 3Quantification of histopathologic changes in the lungs of A/Solomon Islands/3/2006 inoculated cotton rats. The changes were scored on a scale of 0 (normal) to 3 (severe) depending on the severity of lesions. Each bar denotes the mean pathology score ± SD for four animals.
Figure 4Representative immunohistochemical results in tissues from cotton rats inoculated with A/Solomon Islands/3/2006 virus. Formalin-fixed lung sections were processed for hematoxylin and eosin (H&E) and immunohistochemical staining. (A) Mock-infected cotton rat lung tissue at 1 DPI shows no positive signal. (B) Viral antigen was detected in the bronchial epithelial cells at 4 HPI. (C) Extensive viral antigen was detected in the bronchial epithelial cells and cells in the interstitium at 1 DPI. (D) Viral antigen was detected in pneumocytes and interstitial cells in the thickened alveolar wall at 3 DPI. Sections (A)−(C) are at ×200 magnification; (D) is at 400× magnification.
Figure 5Serum antibody titers of cotton rats inoculated with Mock or A/Solomon Islands/3/2006 virus. Sera were taken from four cotton rats at designated time from 1 to 28 DPI. Antibody titers were determined by hemagglutination inhibition (HI) assays using 0.75% guinea pig erythrocytes. Titers are shown as log2 (HI titer) ± SD values.
Figure 6Quantification of the m RNA expression of the IFN-α and Mx genes in A/Solomon Islands/3/2006 infected cotton rat lung tissue. The expression of the IFN-α and Mx1 and Mx2 genes was evaluated chronologically after infection with the virus. Real-time PCR expression levels were normalized using β-actin gene expression as a control. The expression levels are shown as Mean ± SD of the -ΔΔCT value from three replicates. IFN = interferons; Mx = myxovirus-resistance proteins.
Table 1Nucleotide sequences of the primers used in real-time polymerase chain reaction
Target gene |
Primer name |
Primer sequence (5′−3′) |
Amplicon length (bp) |
GenBank ID |
IFN-α |
IFN-α-F |
CCCAGCAGCTCCAGAAGG |
228 |
AF421386
|
IFN-α-R |
TCACAGTCCCCAGCGAGTC |
|
|
Mx1 |
Mx1-F |
CCGGGAGCTGCCAGATTTTGT |
186 |
DQ218274
|
Mx1-R |
GACTTGGCAGCACTGGAGAGGTTA |
|
|
Mx2 |
Mx2-F |
GCGGGTTGCCTTTTCCAGTGTA |
188 |
DQ218273
|
Mx2-R |
GCGAGGCTCCCATGTAAAGTTCTG |
|
|
β-actin |
β-actin-F |
CTGGCTGGCCGGGACCTGAC |
225 |
AF421789
|
β-actin-R |
TCGCTCGTTGCCAATAGTGATGAC |
|
|
Table 2Viral titers in the lung and nose of cotton rats inoculated with A/Solomon Islands/3/2006 virus
Organ |
Viral titer (mean log10 PFU ± SD/ml)a
|
Day post-inoculation
|
4 hr |
1 |
2 |
3 |
4 |
5 |
6–28 |
Lung |
5.3 ± 0.1 |
6.7 ± 0.1 |
4.3 ± 0.2 |
2.4 ± 0.5 |
4.4 |
−b
|
− |
Nose |
− |
4.4 ± 0.1 |
− |
− |
− |
− |
− |