Introduction

Dengue virus (DENV) is a single-stranded, positive-sense RNA virus belonging to the genus Flavivirus, family Flaviviridae [1]. The four antigenically distinct serotypes (DENV-1, -2, -3, and -4) cause various forms of illness, ranging from inapparent infection or classic dengue fever (DF) to severe and life-threatening dengue hemorrhagic fever/dengue shock syndrome [2]. DENV infections are now endemic in more than 100 countries in tropical and subtropical regions, with an estimated 50 million infections annually [3,4].

With increasing international air travel, DENV infection is a potential risk for travelers to tropical areas where dengue is endemic or epidemic. As the numbers of imported cases grow, dengue is increasingly recognized as a serious public health problem in non-endemic countries [5–8]. In South Korea, the diagnosis of dengue began in 2001 at the Division of Arboviruses, Korea National Institute of Health using a commercial immunochromatographic test kit. To date, no indigenous DENV transmissions have been reported in Korea. However, cases of imported dengue infection have been diagnosed in travelers returning from endemic or epidemic areas. Studies of the DENV isolated from travelers have provided useful information about the strains circulating in tropical regions, especially in countries that do not promptly analyze their domestic isolates, and have revealed the emergence of novel DENV strains and a genotype shift in countries [9,10].

Although a positive result using a commercial serologic kit is one of the indications of DENV infection, it should be confirmed using other diagnostic tools. For this reason, since July 2006, laboratory testing in Korea has been followed up using a reverse transcriptase-polymerase chain reaction (RT-PCR) and virus isolation. In this study, we isolated DENV serotype-1 (DENV-1) strains for the first time in Korea and analyzed the phylogenetic relationships of these DENV-1 isolates.

Materials and Methods

2.1 Serum samples

Serum samples from patients with dengue-like symptoms were forwarded to the Division of Arboviruses at Korea National Institute of Health for serologic diagnosis. Between January 2004 and June 2006, a total of 278 serum samples were collected. The specimens were tested using the Panbio Dengue Duo IgM/IgG Rapid Strip Test (PanBio, Queensland, Australia) [11,12]. Of these, 11 early symptomatic-phase sera that were negative in the serologic test (but in convalescent- phase serum were positive) were further tested by virus isolation and RT-PCR (Table 1).

2.2 Virus isolation

Invertebrate C6/36 cells (CRL 1660; American Type Culture Collection) were grown in 25 cm² tissue culture flasks at 30°C in minimum essential medium (MEM) supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 μg/mL streptomycin. The cells were treated with 1 mL of each of the 11 sera diluted 1:10 with MEM containing 2% FBS and antibiotics. After adsorption for 2 hours, the cells were washed once with phosphate-buffered saline and cultured in maintenance medium at 30°C. The culture supernatants were collected seven days after infection, clarified by centrifugation, and stored at −70°C for analysis. The remaining cells were suspended in phosphate-buffered saline, spotted onto Teflon-coated slides, and tested for the presence of viruses before virus typing by immunofluorescence assay (IFA). In the IFA, the cells were stained with commercially available monoclonal antibodies (mAbs; Chemicon International, CA, USA) that were either reactive with all DENV serotypes or were specific for individual serotypes [13]. When viruses could not be typed with these mAbs, other mAbs (D2-1F1-3 for DENV-1, 3H5-1-21 for DENV-2, D6-8A1-12 for DENV-3, and 1H10-6-7 for DENV-4) donated by the Centers for Disease Control and Prevention (CDC, USA) were used instead [14]. Three more passages were performed if the IFA and RT-PCR were negative. Specimens that gave no positive result after the third passage were regarded as negative.

2.3 Multiplex RT-PCR

To type the DENV, multiplex RT-PCR was performed using the primer pairs reported by Harris et al [15]. Viral RNA was extracted from serum samples and culture supernatants using the QIAamp viral RNA mini kit (Qiagen, Hilden, Germany). The RNA was reverse transcribed and amplified using the Qiagen One Step RT-PCR kit and the Multiplex PCR kit (Qiagen). RNA (5 μL) was added to 45 μL of reaction mixture containing 10 μL of 5× reaction buffer, 0.4 mM of each of the four dNTPs, 0.6 μM of the D1 and D2 primer pair and 2 μL of enzyme mix. Reverse transcription was conducted at 50°C for 30 minutes, followed by denaturation at 95°C for 15 minutes.

Thereafter, the cDNA was amplified in 30 cycles of denaturation at 94°C for 15 seconds, annealing at 58°C for 30 seconds and extension at 72°C for 1 minute. The second-round multiplex PCR used 1 μL of template, diluted 1:100 from the initial amplification reaction. Each reaction mixture (50 μL) contained 25 μL of 2× PCR Master Mix and 5 μL of 10× primer mix (containing 2 μM of each of the D1, TS1–TS3 and DEN4 primers). The reaction was performed with the following conditions: 95°C for 15 minutes, followed by 30 cycles of 94°C for 30 seconds, 57°C for 90 seconds, 72°C for 30 seconds and a final extension for 5 minutes at 72°C. The RT-PCR products were analyzed by 1.5% agarose gel electrophoresis and the serotypes were determined according to the product sizes (DENV-1, 482 bp; DENV-2, 119 bp; DENV-3, 290 bp; and DENV-4, 389 bp).

2.4 Nucleotide sequencing and phylogenetic analysis

The initial culture supernatants assigned to DENV-1 were used to amplify the complete envelope (E) gene without any further passage. RT-PCR was performed using the SuperScript III First-Strand Synthesis System and AccuPrime Pfx DNA Polymerase (Invitrogen, CA, USA) with the primer pairs reported by Goncalvez et al [16]. The amplified products (∼1.8 kb) were purified with the QIAquick Gel Extraction Kit (Qiagen) and sequenced in both directions using the ABI PRISM BigDye Terminator Cycle Sequencing Kits and ABI 3730xl sequencer (Applied Biosystems, CA, USA) according to the manufacturer’s instructions. At least two independent PCR products were sequenced using the primers listed in Table 2. The resulting nucleotide sequences were compiled using the SeqMan program in the Lasergene software version 5.06 (DNASTAR, WI, USA) and identified by BLAST searches. A total of 40 E gene sequences for DENV-1 strains were used in the sequence comparison and phylogenetic analyses (Table 3). Multiple alignments of the sequences were generated using ClustalW version 1.83 with default alignment parameters. Phylogenetic trees for aligned nucleotide sequences were constructed with the MEGA-4.0 [17]. The Kimura 2-parameter and Tamura-Nei model were used as substitution models with the neighbor-joining method available in the MEGA-4.0. The reliability of the grouping in the trees was evaluated by the bootstrap resampling method (1,000 replicates). The E gene sequence of DENV-3 (GenBank ID: NC_001475) was used as the out-group in constructing the tree.

Results

3.1 Virus isolation and serotyping

The presence and serotypes of DENV in the cultures were determined by both multiplex RT-PCR and IFA. DENV-specific RNA was detected in all 11 serum samples (Figure 1A). A case of concurrent infection with two serotypes of DENV (serotypes 1 and 2) was detected in the serum sample of one patient (Patient 47). Virus isolation was successful in seven of the 11 serum samples (Figures 1B and 2). The seven isolates were all assigned to DENV-1 according to the sizes of the multiplex RT-PCR products and their reactivity against serotype-specific antibodies.

3.2 Sequence comparison and phylogenetic analysis

The nucleotide and deduced amino acid sequences of the E gene (1485 bp in length) of the isolates were compared with 35 previously published sequences for DENV-1 strains. Of the seven isolates recovered in this study, the E genes of DenKor-02, -03, and -4 showed 100% identity at the nucleotide sequence level. These three strains were isolated from patients who had traveled to Indonesia together (Table 1). In the following analyses, we used DenKor-02 as the representative isolate for all of them. Five isolates (DenKor-01, -02, -05, -06, and -07) showed various sequence similarities, ranging from 90.6% to 99.6% and 95.6% to 100% at the nucleotide and amino acid levels respectively, with the other 35 DENV-1 strains (data not shown).

The sequences of the 11 isolates analyzed in this work revealed nucleotide similarities of 90.6–99.1% and amino acid similarities of 96.6–99.8%. The highest nucleotide sequence similarity of 99.1% (14 nucleotide changes and one amino acid change) was observed between DenKor-05 and DenKor-06. Based on the E gene sequences of DENV-1, the genetic relationships between the 35 previously published strains and the five isolates that showed sequence similarities to them were determined and grouped into five genotypes according to the genotype classification suggested in a previous study (Figure 3) [6]. DenKor-01, isolated from a patient who had visited India and Singapore, fell into genotype V and grouped with a strain from Singapore. DenKor-02, -05, and -06 clustered into genotype I. DenKor-07 fell into genotype IV and grouped with strains from the Philippines and India.

Discussion

Up until June 2006, we carried out laboratory diagnoses using antibody detection with the PanBio Dengue Duo IgM/IgG Rapid Strip Test. A positive result with a commercial test kit is often accepted as evidence of DENV infection [12]. However, diagnosis of DENV infection using a commercial test kit alone is not reliable in terms of sensitivity and specificity, and a definitive diagnosis should be made in conjunction with other laboratory findings [2,18]. Moreover, because vaccination against Japanese encephalitis is widely used in South Korea [19], it is important to note that serological cross-reactions between the two flaviviruses are probable. From this viewpoint, despite a travel history to endemic regions, some of the 74 cases diagnosed in our laboratory can only be considered probable DENV infections. Conversely, because most of the samples that we obtained were single-phase sera, if the samples had been collected prior to antibody production, some of the test results might be false negatives. Therefore, the true number of DENV infections might have been underestimated in our laboratory findings.

It is interesting that the identical DENV-1 strains (DenKor-02, -03, and -04) were isolated from the sera of three patients who had traveled to Indonesia together. The possibility of cross contamination among serum samples was excluded in our study because three independent experiments with the original serum samples were carried out. The possibility that several persons were infected within a short time by a single mosquito has been proposed in previous studies [20–23].

A dual co-infection with two serotypes of DENV (Type 1 and 2) in a patient who had traveled to India and Singapore in August 2004 (Patient 47) was found. The first documented case of concurrent infections with more than one serotype of DENV was reported in Puerto Rico in 1982 [24]. Since then, several cases have been reported in New Caledonia, Thailand, Somalia, Mexico, and China [25–28]. The reason for dual infections is explained by the unique feeding behavior of Aedes aegypti mosquitoes. Because the female mosquito often feeds on several individuals during a single gonotropic cycle, there is a chance that it will be dually infected and then transmit multiple viruses to a single individual [22,23]. We failed to isolate both serotypes of DENV from this patient by viral culture. Two previous studies suggested that, in a culture, the direct competition of viruses leads to a failure to detect the different serotypes of DENV by RT-PCR or IFA [26,27]. It has been suggested that concurrent infection might be associated with the more severe forms of the disease [29]. However, primarily because there are too few cases available to verify the hypothesis, this remains to be investigated further. In the present study, we found no association between dual infection and disease severity.

In summary, for the first time in South Korea, we isolated seven DENV-1 strains from imported cases. Sequence and phylogenetic analysis indicated that frequent genetic changes occurred in DENV-1 strains throughout the world. Importantly, because the vector mosquito, Aedes albopictus, already exists in the country, an extensive surveillance program should be urgently implemented in South Korea.

Acknowledgements

Acknowledgement

This research was supported by the Korea National Institute of Health, Korea Centers for Disease Control and Prevention (Grant: 4847-300-210-13).

Article information

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

References

• 1. Chambers T.J., Hahn C.S., Galler R.. Flavivirus genome organization, expression, and replication. Annu Rev Microbiol 44:1990;649−688. ArticlePubMed
• 2. Gubler D.J.. Dengue and dengue hemorrhagic fever. Clin Microbiol Rev 11(3). 1998 Jul;480−496. ArticlePubMed
• 3. WHO . Dengue haemorrhagic fever: diagnosis, treatment, prevention and control. Available at:. 1997. http://www.who.int/csr/resources/publications/dengue/Denguepublication/en/. [Date accessed: May 2008].
• 4. WHO. Dengue and dengue heamorrhagic fever – Fact sheet no. 117. Available at:. 2002. http://www.who.int/mediacentre/factsheets/fs117/en/. [Date accessed: May 2008].
• 5. Potasman I., Srugo I., Schwartz E.. Dengue seroconversion among Israeli travelers to tropical countries. Emerg Infect Dis 5(6). 1999 Nov–Dec;824−827. ArticlePubMed
• 6. Lindback H., Lindback J., Tegnell A.. Dengue fever in travelers to the tropics, 1998 and 1999. Emerg Infect Dis 9(4). 2003 Apr;438−442. ArticlePubMed
• 7. Frank C., Schoneberg I., Krause G.. Increase in imported dengue, Germany, 2001–2002. Emerg Infect Dis 10(5). 2004 May;903−906. ArticlePubMed
• 8. Wichmann O., Lauschke A., Frank C.. Dengue antibody prevalence in German travelers. Emerg Infect Dis 11(5). 2005 May;762−765. ArticlePubMed
• 9. Nukui Y., Tajima S., Kotaki A.. Novel dengue virus type 1 from travelers to Yap State, Micronesia. Emerg Infect Dis 12(2). 2006 Feb;343−346. ArticlePubMed
• 10. Ito M., Yamada K., Takasaki T.. Phylogenetic analysis of dengue viruses isolated from imported dengue patients: possible aid for determining the countries where infections occurred. J Travel Med 14(4). 2007 Jul–Aug;233−244. ArticlePubMed
• 11. Cuzzubbo A.J., Endy T.P., Nisalak A.. Use of recombinant envelope proteins for serological diagnosis of dengue virus infection in an immunochromatographic assay. Clin Diagn Lab Immunol 8(6). 2001 Nov;1150−1155. ArticlePubMed
• 12. Kittigul L., Suankeow K.. Use of a rapid immunochromatographic test for early diagnosis of dengue virus infection. Eur J Clin Microbiol Infect Dis 21(3). 2002 Mar;224−226. ArticlePubMed
• 13. Henchal E.A., Gentry M.K., McCown J.M.. Dengue virus-specific and flavivirus group determinants identified with monoclonal antibodies by indirect immunofluorescence. Am J Trop Med Hyg 31(4). 1982 Jul;830−836. ArticlePubMed
• 14. Henchal E.A., McCown J.M., Seguin M.C.. Rapid identification of dengue virus isolates by using monoclonal antibodies in an indirect immunofluorescence assay. Am J Trop Med Hyg 32(1). 1983 Jan;164−169. ArticlePubMed
• 15. Harris E., Roberts T.G., Smith L.. Typing of dengue viruses in clinical specimens and mosquitoes by single-tube multiplex reverse transcriptase PCR. J Clin Microbiol 36(9). 1998 Sep;2634−2639. ArticlePubMed
• 16. Goncalvez A.P., Escalante A.A., Pujol F.H.. Diversity and evolution of the envelope gene of dengue virus type 1. Virology 303(1). 2002 Nov;110−119. ArticlePubMed
• 17. Tamura K., Dudley J., Nei M.. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24(8). 2007 Aug;1596−1599. ArticlePubMed
• 18. Guzman M.G., Kouri G.. Dengue diagnosis, advances and challenges. Int J Infect Dis 8(2). 2004 Mar;69−80. ArticlePubMed
• 19. Sohn Y.M.. Japanese encephalitis immunization in South Korea: past, present, and future. Emerg Infect Dis 6(1). 2000 Jan–Feb;17−24. PubMed
• 20. Gubler D.J., Rosen L.. A simple technique for demonstrating transmission of dengue virus by mosquitoes without the use of vertebrate hosts. Am J Trop Med Hyg 25(1). 1976 Jan;146−150. ArticlePubMed
• 21. Putnam J.L., Scott T.W.. Blood-feeding behavior of dengue-2 virus-infected Aedes aegypti. Am J Trop Med Hyg 52(3). 1995 Mar;225−227. ArticlePubMed
• 22. Platt K.B., Linthicum K.J., Myint K.S.. Impact of dengue virus infection on feeding behavior of Aedes aegypti. Am J Trop Med Hyg 57(2). 1997 Aug;119−125. ArticlePubMed
• 23. Scott T.W., Naksathit A., Day J.F.. A fitness advantage for Aedes aegypti and the viruses it transmits when females feed only on human blood. Am J Trop Med Hyg 57(2). 1997 Aug;235−239. ArticlePubMed
• 24. Gubler D.J., Kuno G., Sather G.E.. A case of natural concurrent human infection with two dengue viruses. Am J Trop Med Hyg 34(1). 1985 Jan;170−173. ArticlePubMed
• 25. Laille M., Deubel V., Sainte-Marie F.F.. Demonstration of concurrent dengue 1 and dengue 3 infection in six patients by the polymerase chain reaction. J Med Virol 34(1). 1991 May;51−54. ArticlePubMed
• 26. Kanesa-thasan N., Chang G.J., Smoak B.L.. Molecular and epidemiologic analysis of dengue virus isolates from Somalia. Emerg Infect Dis 4(2). 1998 Apr–Jun;299−303. ArticlePubMed
• 27. Lorono-Pino M.A., Cropp C.B., Farfan J.A.. Common occurrence of concurrent infections by multiple dengue virus serotypes. Am J Trop Med Hyg 61(5). 1999 Nov;725−730. ArticlePubMed
• 28. Wenming P., Man Y., Baochang F.. Simultaneous infection with dengue 2 and 3 viruses in a Chinese patient return from Sri Lanka. J Clin Virol 32(3). 2005 Mar;194−198. ArticlePubMed
• 29. Hammon W.M.. Dengue hemorrhagic fever — do we know its cause? Am J Trop Med Hyg 22(1). 1973 Jan;82−91. ArticlePubMed
• 30. Laille M., Roche C.. Comparison of dengue-1 virus envelope glycoprotein gene sequences from French Polynesia. Am J Trop Med Hyg 71(4). 2004 Oct;478−484. ArticlePubMed

Figure 1

Identification of dengue virus (DENV) serotypes from (A) the original serum samples and (B) culture supernatants by multiplex RT-PCR. The patient code number is shown at the top. Lane M = 100-bp ladder; Lane C = negative control; Lane 1 = DENV-1 (Hawaii) positive; Lane 2 = DENV-2 (New Guinea C) positive; Lane 3 = DENV-3 (H87) positive; Lane 4 = DENV-4 (H241) positive. The expected sizes of the RT-PCR products were as follows: DENV-1 = 482 bp; DENV-2 = 119 bp; DENV-3 = 290 bp; and DENV-4 = 389 bp.

Figure 2

Detection and typing of dengue virus (DENV) isolates using monoclonal antibodies. The culture of C6/36 cells injected with patient serum (patient code. 115/2005) was harvested and stained (A) with monoclonal antibodies reactive with all DENV serotypes (MAB 8705, Chemicon International, USA) and (B) with DENV serotype-1 specific antibodies (D2-1F1-3, Centers for Disease Control and Prevention, USA). (C) is the negative control (non-infected C6/36 cells, reacted with MAB 8705).

Figure 3

Phylogenetic tree based on the nucleotide sequences of the envelope gene from 40 dengue type-1 viruses. The tree was constructed by the neighbor-joining method (Tamura-Nei substitution model) and rooted using a reference strain of dengue type-3 virus (GenBank ID: NC_001475). The percentages of bootstrap values are shown at each node (1,000 replicates). Genotypes I, II, IV and V are as defined in previous studies [16,30].

Table 1

Summary of the patient information

Patient code/yr	Travel history	Serotype by RT-PCRa	Virus isolationb
			IFA	RT-PCR	Designation
32/2004	IU	2	–	–
38/2004	IU	3	–	–
47/2004	India, Singapore	1, 2	1	1	DenKor-01
09/2005	Indonesia	1	1	1	DenKor-02
10/2005	Indonesia	1	1	1	DenKor-03
12/2005	Indonesia	1	1	1	DenKor-04
35/2005	Thailand	1	1	1	DenKor-05
51/2005	Philippines	4	–	–
108/2005	India	1	–	–
115/2005	Thailand	1	1	1	DenKor-06
64/2006	Philippines	1	1	1	DenKor-07

IU = information unavailable; the dash (–) = negative; RT-PCR = reverse transcriptase-polymerase chain reaction; IFA = immunofluorescence assay.

^aTested with original serum samples;

^bVirus isolation and typing.

Table 2

Primers for amplification and sequencing of the envelope (E) gene of dengue type-1 viruses

Name	Sequence (5′–3′)	Positiona	Use
D1-820-S	GAGACACCCAGGATTCACGG	820–839	RT-PCR, Sequencing
D1-2600-AS	TGGCTGATCGAATTCCACAC	2581–2600	RT-PCR, Sequencing
1198-S	GAACTTTGTGTGYCGACGAAC	1198–1218	Sequencing
1556-S	GTCCACAAACAATGGTTTC	1556–1574	Sequencing
1913-S	GAAGGAACAGATGCACCATG	1913–1932	Sequencing
1440-AS	GGAGCTTGAGGTGTTAT	1424–1440	Sequencing
1932-AS	CATGGTGCATCTGTTCCTTC	1913–1932	Sequencing

RT-PCR = reverse transcriptase-polymerase chain reaction.

^aPosition refers to the position in the genome of the WestPac 74 strain (GenBank ID: U88535).

Table 3

Details of the dengue type-1 viruses used in this study

Strain	Code	Location	Isolation yr	GenBank IDa
RIO H 36589	Ang88	Angola	1988	AF425610
495–1	Aru88	Aruba	1985	AF425609
AUS HATI7	Aus83	Australia	1983	AF425612
BE AR 404147	Bra82	Brazil	1982	AF425613
BR/90	Bra90	Brazil	1990	S64849
BR/01-MR	Bra01	Brazil	2001	AF513110
GZ/80	Chi80	China	1980	AF350498
INS 347869	Col85	Columbia	1985	AF425616
D1/H/IMTSSA/98/606	Dji98	Ethiopia	1998	AF298808
FGA/89	Fre89	French Guiana	1989	AF226687
A88	Ind88	Indonesia	1988	AB074761
98901518 DHF DV-1	Ind98	Indonesia	1998	AB189120
02-07-1HuNIID	Ind02	Indonesia	2002	AB111073
SC01	Ind04	Indonesia	2004	AY858983
DenKor-02	Ind05	Indonesia	2005	EF654105
PRS 288690	Jam77	Jamaica	1977	AF425621
1298/TVP 951	Mex80	Mexico	1980	AF425623
PRS 228686	Mya76	Myanmar	1976	AF425615
My01D138862	Mya01	Myanmar	2001	AY618210
WestPac 74	WestPac 74	Nauru	1974	U88535
PRS 228682	Phi74	Philippines	1974	AF425627
01St219	Phi01	Philippines	2001	AY422777
02RBD008	Phi02	Philippines	2002	AY422778
DenKor-07	DenKor-07	Philippines	2006	EF654110
Singapore 8114/93	Sin93	Singapore	1993	AY762084
S144/02	Sin02	Singapore	2002	EU069600
T3196/04	Sin04	Singapore	2004	EU069624
DenKor-01	DenKor-01	India, Singapore	2004	EF654104
D1/SG/05K4173DK1/2005	Sin05	Singapore	2005	EU081262
D1/SG/06K2290DK1/2006	Sin06	Singapore	2006	EU081281
TH-SMAN	Tha54	Thailand	1954	D10513
2543–63	Tha63	Thailand	1963	AF425629
16007	Tha64	Thailand	1964	AF180817
PUO 359	Tha80	Thailand	1980	AF425630
ThD1_K0229_90	Tha90	Thailand	1990	AY732466
ThD1_K0051_99	Tha99	Thailand	1999	AY732458
ThD1_0075_02	Tha02	Thailand	2002	AY732398
DenKor-05	DenKor-05	Thailand	2005	EF654108
DenKor-06	DenKor-06	Thailand	2005	EF654109
5345	Ven95	Venezuela	1995	AF425635

^aThe bold ID numbers indicate the sequences that were determined in this study.

Figure & Data

References

Citations

Citations to this article as recorded by  

• Genotypic persistence of dengue virus in the Philippines
  Ma. Jowina Galarion, Brian Schwem, Coleen Pangilinan, Angelo dela Tonga, Joy Ann Petronio-Santos, Erlinda delos Reyes, Raul Destura
  Infection, Genetics and Evolution.2019; 69: 134.     CrossRef
• Neutralization of Acidic Intracellular Vesicles by Niclosamide Inhibits Multiple Steps of the Dengue Virus Life Cycle In Vitro
  Eunhye Jung, Sangwoo Nam, Hyeryeon Oh, Sangmi Jun, Hyun-Joo Ro, Baek Kim, Meehyein Kim, Yun Young Go
  Scientific Reports.2019;[Epub]     CrossRef
• Seroprevalence of Dengue Virus Antibody in Korea
  Ji Hyen Lee, Han Wool Kim, Kyung-Hyo Kim
  Pediatric Infection & Vaccine.2018; 25(3): 132.     CrossRef
• Circulating Genotypes of Dengue-1 Virus in South West India, 2014–2015
  Shetty Pooja, Sasidharanpillai Sabeena, Bhaskar Revti, Ramachandran Sanjay, Aithal Anjali, Kumar Rajendra, Sushama Aswathyraj, Dsouza Giselle, Maity Hindol, Govindakarnavar Arunkumar
  Japanese Journal of Infectious Diseases.2017; 70(6): 663.     CrossRef
• WITHDRAWN: A disease around the corner
  Hae-Wol Cho, Chaeshin Chu
  Osong Public Health and Research Perspectives.2016;[Epub]     CrossRef
• A Disease Around the Corner
  Hae-Wol Cho, Chaeshin Chu
  Osong Public Health and Research Perspectives.2016; 7(1): 1.     CrossRef
• Prevalence of Neutralizing Antibodies to Japanese Encephalitis Virus among High-Risk Age Groups in South Korea, 2010
  Eun Ju Lee, Go-Woon Cha, Young Ran Ju, Myung Guk Han, Won-Ja Lee, Young Eui Jeong, Nagendra R Hegde
  PLOS ONE.2016; 11(1): e0147841.     CrossRef
• Laboratory-acquired dengue virus infection by needlestick injury: a case report, South Korea, 2014
  Changhwan Lee, Eun Jung Jang, Donghyok Kwon, Heun Choi, Jung Wan Park, Geun-Ryang Bae
  Annals of Occupational and Environmental Medicine.2016;[Epub]     CrossRef
• A Pan-Dengue Virus Reverse Transcription-Insulated Isothermal PCR Assay Intended for Point-of-Need Diagnosis of Dengue Virus Infection by Use of the POCKIT Nucleic Acid Analyzer
  Yun Young Go, R. P. V. Jayanthe Rajapakse, Senanayake A. M. Kularatne, Pei-Yu Alison Lee, Keun Bon Ku, Sangwoo Nam, Pin-Hsing Chou, Yun-Long Tsai, Yu-Lun Liu, Hsiao-Fen Grace Chang, Hwa-Tang Thomas Wang, Udeni B. R. Balasuriya, M. J. Loeffelholz
  Journal of Clinical Microbiology.2016; 54(6): 1528.     CrossRef
• Comparison of the Epidemiological Aspects of Imported Dengue Cases between Korea and Japan, 2006–2010
  Young Eui Jeong, Won-Chang Lee, Jung Eun Cho, Myung-Guk Han, Won-Ja Lee
  Osong Public Health and Research Perspectives.2016; 7(1): 71.     CrossRef
• Complete Genome Sequences of Three Clinical Isolates of Dengue Virus Serotype 1 from South Korean Travelers
  Yun Young Go, Eunhye Jung, Young Eui Jeong, Udeni B. R. Balasuriya
  Genome Announcements.2015;[Epub]     CrossRef
• Comparison of Four Serological Tests for Detecting Antibodies to Japanese Encephalitis Virus after Vaccination in Children
  Go Woon Cha, Jung Eun Cho, Young Ran Ju, Young-Jin Hong, Myung Guk Han, Won-Ja Lee, Eui Yul Choi, Young Eui Jeong
  Osong Public Health and Research Perspectives.2014; 5(5): 286.     CrossRef
• Dengue virus type 1 clade replacement in recurring homotypic outbreaks
  Boon-Teong Teoh, Sing-Sin Sam, Kim-Kee Tan, Jefree Johari, Meng-Hooi Shu, Mohammed Bashar Danlami, Juraina Abd-Jamil, NorAziyah MatRahim, Nor Muhammad Mahadi, Sazaly AbuBakar
  BMC Evolutionary Biology.2013;[Epub]     CrossRef
• Travel-Associated Chikungunya Cases in South Korea during 2009–2010
  Go Woon Cha, Jung Eun Cho, Eun Ju Lee, Young Ran Ju, Myung Guk Han, Chan Park, Young Eui Jeong
  Osong Public Health and Research Perspectives.2013; 4(3): 170.     CrossRef
• The Road Less Traveled
  Chaeshin Chu
  Osong Public Health and Research Perspectives.2011; 2(1): 1.     CrossRef