1. Introduction

Over the past three decades, Acinetobacter baumannii has emerged as an important nosocomial pathogen worldwide [1]. Certain strains of A baumannii are now resistant to many common antimicrobial agents, including fluoroquinolone, and multidrug resistance is often responsible for the failure of antibiotic therapy [2,3]. Resistance to fluoroquinolone is mediated primarily through spontaneous mutations of genes in the quinolone resistance-determining region (QRDR), namely, DNA gyrase and topoisomerase IV. Alterations in the drug target due to modifications in the genes for DNA gyrase subunit A (gyrA) or topoisomerase IV subunit C (parC) have been associated with high levels of resistance to fluoroquinolones [4-6]. A secondary cause of resistance to fluoroquinolone is alterations in the efflux pump that lead to active efflux of the drug. Efflux pumps typically have broad substrate specificity that contributes to resistance against multiple unrelated classes of drug, including aminoglycosides, tetracycline, fluoroquinolones, trimethoprim and chloramphenicol [7,8].

DNA gyrase is the target of a number of quinolones,including ciprofloxacin, levofloxacin, gemifloxacin and gatifloxacin [9,10]. Quinolones produce bacteriostatic activity by binding rapidly to the enzyme-DNA complex, probably before DNA cleavage occurs, thereby blocking DNA replication and transcription. The quinolones can bind to the complexes even with mutations in the genes for DNA gyrase or topoisomerase IV that result in an inability to cleave DNA [11,12]. The protein product of gyrB consists of two domains:a 43-kDa N-terminal domain containing a site for ATP binding and hydrolysis that is thought to act as a DNA clamp; and a 47-kDa C-terminal domain that is thought to play a role in strand passage and interactions with gyrA and DNA. GyrA and GyrB form a functional A2B2 tetramer [11,12].

Many fluoroquinolone-resistant clinical isolates of A baumannii have emerged rapidly in South Korea [13,14]. There are, however, few studies on the resistance to fluoroquinolone and the prevalence of mutations in the genes for DNA gyrase and topoisomerase IV in clinical isolates of A baumannii from the South Korean population. The role of the A baumannii efflux pump on fluoroquinolone resistance has not been fully investigated. Therefore, the aim of this study was to investigate the mechanisms of resistance to fluoroquinolone in clinical isolates of A baumannii from non-tertiary hospitals in South Korea. Specifically, we assessed: (i) the presence of mutations in the gyrA, gyrB and parC genes and the effect of different mutations on resistance to fluoroquinolone; and (ii) the presence of alterations in the efflux pump mechanism and their effects on resistance to fluoroquinolone.

2. Method and Materials

2.1. Bacterial strains and growth conditions

Fifty-six nonrepetitive clinical isolates of fluoroquinolone-resistant A baumannii from non-tertiary hospitals, collected between 2004 and 2006, were selected for this study. The A baumannii isolates were compared with the reference Escherichia coli ATCC 25922 strain (American Type Culture Collection, Manassas, VA, USA) for minimal inhibitory concentration (MIC) analysis and with the A baumannii ATCC 19606 strain for QRDR analysis. The clinical isolateswere propagated at 37℃ in nutrient broth or agar. The clinical isolates and reference bacteria were propagated aerobically at 37℃ in Luria-Bertani (LB) broth until they reached mid-log growth. The clinical isolates were identified using the Vitek II automatic system (bioMerieux, Carcy-I’Etole , France).

2.2. Antimicrobial susceptibility testing

The MICs for ciprofloxacin, gemifloxacin, levofloxacin, norfloxacin and gatifloxacin were determined by Epsilometer test (Etest, AB BIODISK, Piscataway, NJ, USA) and the broth microdilution method, following the manufacturer’s instructions, which were based on the guidelines of the Clinical and Laboratory Standards Institute [15]. The MIC for each drug was determined by a serial dilution of test compounds (Sigma-Aldrich, St Louis, MO, USA) in Mueller-Hinton broth (Becton Dickinson & Co., Sparks, MD, USA) with the bacteria at a density of 5 × 10⁵ colony-forming units/mL. Plates were incubated at 37℃ for 20 hours and growth was then assayed by measuring the optical density at 595 nm.

2.3. Quinolone resistance-determining region analysis

The QRDR analysis was conducted using the control sequence for gyrA (DQ270238), gyrB (CU468230) and parC (X95816). The primers were used to amplify the DNA and for sequencing (Table 1). Genomic DNA was extracted from the prepared isolates using the Qiagen genomic DNA purification kit (Qiagen, Hilden, Germany). Universal polymerase chain reaction (PCR) was used to confirm that the DNA samples contained the fluoroquinolone resistance genes (Table 1). A 1:100 dilution of DNA in Tris-EDTA (TE) buffer was used in the PCR. DNA amplification was carried out in a GeneAmp PCR system 2400 (Applied Biosystems, Foster City, CA, USA) instrument with initial denaturation at 95℃ for 2 minutes followed by 30 cycles of amplification (denaturation at 95℃ for 30 seconds, then annealing for 30 seconds at primer set-specific temperatures, and extension at 72℃ for 1 minute), ending with a final extension at 72℃ for 5 minutes. The PCR products were stained with ethidium bromide and photographed with ultraviolet illumination.

2.4. Treatment of efflux pump inhibitors

The growth inhibition assays were conducted as described previously [16], using efflux pump inhibitors

Table 1.

Primer sequences

Target gene	Primer name	Sequences (5ʹ to 3ʹ)	Usage	Temp (℃)	Product size (bp)	ATCC No.
gyrA	gyrA_F	AAATCTGCCCGTGTCGTTGGT	amp*	58	344	DQ270238
	gyrA_R	GCCATACCTACGGCGATACC	amp
gyrB	gyrB_SDF_F	ATGAGTTCAGAGTCTCAATC	amp/seq✝	60	2980	CU468230
	gyrB_SDF_R	TTAAGCATCAATATCCGCAATT	amp
	gyrB_SDF_601	GCACGCCGTTTACGTGAGCT	seq
	gyrB_SDF_1201	GCACGTGAAATGACACGCCG	seq
	gyrB_SDF_1801	CAAGTTTCACAAAAGAGCTT	seq
parC	parC_F	ATGAGCGAGCTAGGCTTAAA	amp	58	300	X95816
	parC_R	TTAAGTTGTCCTTGCCATTCA	amp

*amp=;[amplification OR amplified] prime;^✝seq=sequencing primer.

(EPIs) including carbonyl cyanide 3-chlorophenylhydrazone (CCCP), 1-(1-naphthylmethyl)-piperazine (NMP), phenyl-arginine-β-naphthylamide (PAβN), reserpine and verapamil (Sigma-Aldrich, St. Louis, MO, USA). The antimicrobial susceptibility test was conducted with levofloxacin, ciprofloxacin, gemifloxacin and norfloxacin in the presence or absence of each EPI at the following concentrations: 25 μg/mL PAβN, 10 μg/mL CCCP, 50 μg/mL NMP, 50 μg/mL reserpine and 100 μg/mL verapamil. Each EPI was tested at least three times.

2.5. Computer analysis of sequence data

Nucleotide sequence data were analyzed using the Clustal W software program (European Bioinformatics Institute, Cambridge, UK) [17]. The amino acid sequences were analyzed at the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov/BLAST). The GenBank and protein databases were screened for sequence similarity. The primer sets were designed using the sequences of the genes for DNA gyrase (gyrA and gyrB) and topoisomerase IV (parC) from the 56 clinical isolates of A baumannii, using the PrimerSelect program from the DNA Lasergene analysis software package (DNASTAR, Inc., Madison, WI, USA).

2.6. Statistical analysis

Statistical testing to determine differences in antimicrobial resistance was conducted using SPSS for MS Windows (version 11.5; SPSS, Inc., Chicago, IL, USA). Continuous variables were compared using Student’s t test, and categorical variables were compared using Fisher’s exact test or chi-squared analysis. A p value of < 0.05 was considered statistically significant.

3. Results

3.1. Novel gyrB mutant sites and amino acid substitutions within QRDRs

The 56 clinical isolates were identified from the QRDR analysis. The isolates were divided into seven groups according to the amino acid substitutions in the protein products of gyrA, gyrB and parC (Table 2). A mutation encoding Ser83→Leu was detected in the QRDR of gyrA in all of the A baumannii isolates studied. Three different mutations were observed in the QRDR of gyrB encoding Glu479→Asp (3.6%), Asp644→Tyr (12.5%) and Ala677→Val (37.5%) in 30 (53.6%) A baumannii isolates. Fifty-three of the 56 A baumannii isolates (94.6%) showed a single mutation in parC encoding Ser80→Leu (30; 53.6%), Ser80→Trp(2; 3.6%) and Glu84→Lys (21; 37.5%). Overall, 27(48.2%) of the 56 fluoroquinolone -resistant A baumannii isolates showed mutations in the QRDR of gyrA, gyrB and parC.

Table 2.

Mutations in the GyrA, GyrB and ParC subunits in A baumannii isolates, and the MIC for different fluoroquinolone in groups of mutant isolates

Mutation groups	No. of isolates	Agent	No. of isolates with MIC (μg/mL)									GyrA	GyrB			ParC
			1	2	4	8	16	32	64	128	>256	S83 (tca)	E479 (gaa)	D644 (gat)	A677 (gcg)	S80 (tcg)	E84 (gaa)
I	3	Ciprofloxacin		1	2							L(tta)		Y(tat)
		Gatifloxacin	3
		Gemifloxacin	3
		Levofloxacin	1	2
II	25	Ciprofloxacin				2	1	20	2			L(tta)				L(ttg)
		Gatifloxacin	1	2	16	6
		Gemifloxacin		2	3	14	5	1
		Levofloxacin		2	17	4	2
III	1	Ciprofloxacin							1
		Gatifloxacin				1						L(tta)				W(tgg)
		Gemifloxacin					1
		Levofloxacin				1
IV	1	Ciprofloxacin								1		L(tta)	D(gat)			L(ttg)
		Gatifloxacin					1
		Gemifloxacin					1
		Levofloxacin					1
V	1	Ciprofloxacin									1	L(tta)	D(gat)			W(tgg)
		Gatifloxacin						1
		Gemifloxacin						1
		Levofloxacin						1
VI	4	Ciprofloxacin					1		2	1		L(tta)		Y(tat)		L(ttg)
		Gatifloxacin				2	1	1
		Gemifloxacin				1		3
		Levofloxacin				2	1	1
VII	21	Ciprofloxacin						11	9			L(tta)			V(gtg)		K(aaa)
		Gatifloxacin			18	2	1
		Gemifloxacin			4	9	8
		Levofloxacin			5	16

A=alanine, D=aspartic acid, E=glutamic acid, K=lysine, L=leucine, MIC=minimal inhibitory concentration, S=serine, V=valine, W=tryptophan, Y=tyrosine.

3.2. MIC for fluoroquinolone in the QRDR mutants

Group I mutants had mutations in gyrA and gyrB and showed resistance to four fluoroquinolones, but their MIC was ≤4 μg/mL. Group II and III mutants had double mutations in gyrA and parC and showed resistance to ciprofloxacin (MIC 8-64 μg/mL), gatifloxacin (MIC 1-8 μg/mL), gemifloxacin (MIC 2-32 μg/mL) and levofloxacin (MIC 2-16 μg/mL). Groups IV, V, VI and VII mutants had triple mutations in gyrA, gyrB and parC. They were resistant to ciprofloxacin (MIC 16-256 μg/mL), gatifloxacin (MIC 4-32 μg/mL), gemifloxacin (MIC 4-32 μg/mL) and levofloxacin (MIC 4-32 μg/mL), p < 0.05). Overall, isolates with triple mutations of gyrA, gyrB and parC had a higher level of resistance to fluoroquinolone than isolates with double mutations of gyrA and parC (p < 0.05).

3.3. Efflux pump analysis

To evaluate the contribution of the efflux pump to the fluoroquinolone-resistant phenotype of five isolates from

Table 3.

The MIC for fluoroquinolone in the absence or presence of EPIs*

Group	Isolate	+ EPI	MIC (mg/mL)				QRDR mutation
			NOR	CIP	GEM	LEV	GyrA	GyrB	ParC
II	5733	alone	>256	>32	25.3	>32	S83L		S80L
		+CCCP	>256	>32	12.7	4.0
		+PAβN	>256	>32	8.0	4.0
		+NMP	>256	>32	19.3	6.0
		+reserpine	>256	>32	24.0	4.0
		+verapamil	>256	>32	15.3	12.0
II	5A38	alone	>256	>32	54.3	>32	S83L		S80L
		+CCCP	>256	>32	11.0	>32
		+PAβN	>256	>32	14.7	4.0
		+NMP	>256	>32	49.3	6.0
		+reserpine	>256	>32	8.0	6.0
		+verapamil	>256	>32	5.5	4.0
III	6018	alone	>256	>32	16.0	8.0	S83L		S80W
		+CCCP	>256	>32	13.3	8.0
		+PAβN	>256	>32	15.3	8.0
		+NMP	>256	>32	13.3	8.0
		+reserpine	>256	>32	36.7	8.0
		+verapamil	>256	>32	38.7	>32
VII	6A69	alone	>256	>32	13.0	>32	S83L	A677V	E84K
		+CCCP	>256	>32	7.3	>32
		+PAβN	>256	>32	6.0	4.0
		+NMP	>256	>32	10.3	6.0
		+reserpine	>256	>32	11.3	6.0
		+verapamil	>256	>32	10.0	12.0
VII	6A80	alone	>256	>32	7.0	>32	S83L	A677V	E84 K
		+CCCP	>256	>32	6.0	>32
		+PAβN	>256	>32	3.7	4.0
		+NMP	>256	>32	7.7	6.0
		+reserpine	>256	>32	7.3	4.0
		+verapamil	>256	>32	3.3	6.0

*Average MIC values were determined by Etest at least three times (standard deviation ± 0.2-12).

CCCP=carbonyl cyanide 3-chlorophenylhydrazone, CIP=ciprofloxacin, EPI=efflux pump inhibitor, GEM=gemifloxacin, LEV=levofloxacin, MIC=minimal inhibitory concentration, NMP=1-(1-naphthylmethyl)-piperazine, NOR=norfloxacin, PAβN=phenylarginine-β-naphthylamide.

different QRDR mutation groups, we compared the MIC for each fluoroquinolone in the presence or absence of CCCP, PAβN, NMP, reserpine and verapamil (Table 3). For four isolates (5733, 5A38, 6A69 and 6A80), the four EPIs PAβN, NMP, reserpine and verapamil significantly reduced the MIC (by two- to eightfold) for levofloxacin. These four isolates belonged to groups II (GyrA S83L; ParC S80L) and VII (GyrA S83L; GyrB A677V; ParC E84K). They showed a high level of resistance to levofloxacin (MIC > 32 μg/mL). The remaining isolate, which was not affected by the EPIs, belonged to group III (GyrA S83L; ParC S80W) and showed less resistance to levofloxacin (8 μg/mL) than the other four isolates.

4. Discussion

The purpose of this study was to investigate mechanisms of resistance to fluoroquinolone in clinical isolates of A baumannii. The results of the present study correspond well with those of earlier studies, which have shown that the most common mechanism of resistance to fluoroquinolone in A baumannii involves alterations in the genes that encode subunits of the quinolone targets DNA GryA (S83L, G81V or C and A84P) and ParC (S80L or W, E84K and G78C) [4-6]. Mutations in the GyrA and GyrB subunits of DNA gyrase and the ParC and ParE subunits of topoisomerase IV play a major role in conferring a high level of resistance to fluoroquinolone in other Gram-negative bacteria, such as E coli and Pseudomonas aeruginosa [18,19]. The outer membrane of A baumannii has been associated with intrinsic antimicrobial resistance resulting from the over-expression of the adeABC and adeFGH efflux pump genes [20,21]. These findings indicate that active efflux is involved in both intrinsic and acquired resistance to fluoroquinolones. The outer membrane of P aeruginosa shows little permeability to small hydrophobic molecules, which may account for the intrinsic resistance of P aeruginosa to quinolones. In fact, the outer membrane of P aeruginosa is 10- to 100-fold less permeable to antimicrobial agents than the outer membrane of E coli [22]. Additional efflux pumps associated with resistance to fluoroquinolone have also been characterized in E coli and other Gram-negative bacteria [22,23].

In the present study, clinical isolates of A baumannii with identical mutations in the QRDR of gyrA, gyrB and parC genes showed very different levels of resistance to fluoroquinolones.

It is controversial whether the efflux pump has a contributory effect on the resistance of A baumannii to fluoroquinolone [2,24]. Although we cannot exclude the presence of QRDR mutations outside of the region that we sequenced, our results suggest that the differences in resistance that were observed were due to differences in the active efflux of fluoroquinolone.

The effects of CCCP and PAβN-that primarily inhibit RND-family efflux pumpseand reserpine and verapamilethat primarily inhibit non-RND-family efflux pumpseon antimicrobial susceptibility have been examined previously [16,25]. Although these inhibitors have preferences for certain classes of pumps, their activity cannot be assumed to be exclusive to one class. The present study showed that the EPIs also reduced the MIC of fluoroquinolone, but only in isolates with clonally related parC mutations (S80L in group II and E84K in group VII). It did not have this effect in the S80W parC mutation (group III).

In conclusion, although a single mutation in DNA gyrase is sufficient for resistance to fluoroquinolone, the accumulation of triple mutations in the QRDR regions of the gyrA, gyrB and ParC genes is expected to significantly contribute to high-level fluoroquinolone resistance. We have demonstrated a role for the efflux pump in conferring resistance to fluoroquinolone in clinical isolates that carry S80L or E84K mutations in parC. Further studies are needed to elucidate the role of over-expression of the efflux pump on fluoroquinolone resistance.

Acknowledgements

This study was supported by an intramural research fund of the Korea Centers for Disease Control and Prevention (No. 2007-N44002-00).

• 1. Perez F Hujer AM Hujer KM et al.. Global challenge of multidrug-resistant Acinetobacter baumannii. Antimicrob Agents Chemother 10;2007;51(10). 3471−84. PMID: 17646423.ArticlePubMedPMC
• 2. Valentine SC Contreras D Tan S et al.. Phenotypic and molecular characterization of Acinetobacter baumannii clinical isolates from nosocomial outbreaks in Los Angeles County, California. J Clin Microbiol 8;2008;46(8). 2499−507. PMID: 18524965.ArticlePubMedPMC
• 3. Spence RP Towner KJ . Frequencies and mechanisms of resistance to moxifloxacin in nosocomial isolates of Acinetobacter baumannii. J Antimicrob Chemother 10;2003;52(4). 687−90. PMID: 12951327.ArticlePubMed
• 4. Vila J Ruiz J Goῇi P Marcos A Jimenez de Anta T . Mutation in the gyrA gene of quinolone-resistant clinical isolates of Acinetobacter baumannii. Antimicrob Agents Chemother 5;1995;39(5). 1201−3. PMID: 7625818.ArticlePubMedPMC
• 5. Vila J Ruiz J Goῇi P Jimenez de Anta T . Quinolone-resistance mutations in the topoisomerase IV parC gene of Acinetobacter baumannii. J Antimicrob Chemother 6;1997;39(6). 757−62. PMID: 9222045.ArticlePubMed
• 6. Hamouda A Amyes SGB . Novel gyrA and parC point mutations in two strains of Acinetobacter baumannii resistant to ciprofloxacin. J Antimicrob Chemother 9;2004;54(3). 695−6. PMID: 15282231.ArticlePubMed
• 7. Ruiz J . Mechanisms of resistance to quinolones: target alterations, decreased accumulation and DNA gyrase protection. J Antimicrob Chemother 5;2003;51(5). 1109−17. PMID: 12697644.ArticlePubMed
• 8. Higgins PG Wisplinghoff H Stefanik D Seifert H . Selection of topoisomerase mutaitons and overexpression of adeB mRNA transcripts during an outbreak of Acinetobacter baumannii. J Antimicrob Chemother 10;2004;54(4). 821−3. PMID: 15355942.ArticlePubMed
• 9. Vila J Ribera A Marco F et al.. Activity of clinafloxacin, compared with six other quinolones, against Acinetobacter baumannii clinical isolates. J Antimicrob Chemother 3;2002;49(3). 471−7. PMID: 11864947.ArticlePubMed
• 10. Seral C Barcia-Macay M Mingeot-Leclercq MP et al.. Comparative activity of quinolones (ciprofloxacin, levofloxacin, moxifloxacin and garenoxacin) against extracellular and intracellular infection by Listeria monocytogenes and Staphylococcus aureus in J774 macrophages. J Antimicrob Chemother 4;2005;55(4). 511−7. PMID: 15731197.ArticlePubMed
• 11. Noble CG Maxwell A . The role of GyrB in the DNA cleavagereligation reaction of DNA Gyrase: a proposed two metal-ion mechanism. J Mol Biol 26 4 2002;318(2). 361−71. PMID: 12051843.ArticlePubMed
• 12. Heddle J Maxwell A . Quinolone-binding pocket of DNA gyrase: role of GyrB. Antimicrob Agents Chemother 6;2002;46(6). 1805−15. PMID: 12019094.ArticlePubMedPMC
• 13. Lee K Chang CL Lee NY et al.. Korean Nationwide Surveillance of Antimicriobial Resistance of Bacteria in 1998. Yonsei Med J 8;2000;41(4). 497−506. PMID: 10992812.ArticlePubMed
• 14. Yong D Cheong HJ Kim YS et al.. In vitro activity of gemifloxacin against recent clinical isolates of bacteria in Korea. J Koran Med Sci 12;2002;17(6). 737−42.Article
• 15. Clinical and Laboratory Standards Institute (CLSI). Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, approved standard - 7th ed.. Wayne, PA: CLSI.: 2007. pp M100−S20.
• 16. Pumbwe L Chang A Smith RL Wexler HM . Clinical significance of overexpression of multiple RND-family efflux pumps in Bacteroides fragilis isolates. J Antimicrob Chemother 9;2006;58(3). 543−8. PMID: 16840432.ArticlePubMed
• 17. Thompson JD Higgins DG Gibson TJ . Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res 11 11 1994;22(22). 4673−80. PMID: 7984417.ArticlePubMedPMC
• 18. Nakamura S Nakamura M Kojima T Yoshida H . gyrA and gyrB mutations in quinolone-resistant strains of Escherichia coli. Antimicrob Agents Chemother 2;1989;33(2). 254−5. PMID: 2655532.ArticlePubMedPMC
• 19. Lee JK Lee YS Park YK Kim BS . Alterations in the GyrA and GyrB subunits of topoisomerase II and the ParC and ParE subunits of topoisomerase IV in ciprofloxacin-resistant clinical isolates of Pseudomonas aeruginosa. Int J Antimicrob Agents 4;2005;25(4). 290−5. PMID: 15784307.ArticlePubMed
• 20. Lina L Linga BD Li XZ . Distribution of the multidrug efflux pump genes, adeABC, adeDE and adeIJK, and class 1 integron genes in multiple-antimicrobial-resistant clinical isolates of Acinetobacter baumannii -Acinetobacter calcoaceticus complex. Int J Antimicrob Agents 1;2009;33(1). 27−32. PMID: 18790612.ArticlePubMed
• 21. Coyne S Rosenfeld N Lambert T et al.. Overexpression of resistance-nodulation-cell division pump AdeFGH confers multidrug resistance in Acinetobacter baumannii. Antimicrob Agents Chemother 10;2010;54(10). 4389−93. PMID: 20696879.ArticlePubMedPMC
• 22. Aeschlimann JR . The role of multidrug efflux pumps in the antibiotic resistance of Pseudomonas aeruginosa and other Gramnegative bacteria. Pharmacotherapy 7;2003;23(7). 916−24. PMID: 12885104.ArticlePubMed
• 23. Poole K . Efflux-mediated resistance to fluorquinolones in gramnegative bacteria. Antimicrob Agents Chemother 9;2000;44(9). 2233−41. PMID: 10952561.ArticlePubMedPMC
• 24. Bratu S Landman D Martin DA et al.. Correlation of antimicrobial resistance with β-lactamases, the OmpA-like porin, and efflux pumps in clinical isolates of Acinetobacter baumannii endemic to NewYork City. Antimicrob. Agents Chemother 9;2008;52(9). 2999−3005.Article
• 25. Pannek S Higgins PG Steinke P et al.. Multidrug efflux inhibition in Acinetobacter baumannii: comparison between 1-(1-naphthylmethyl)-piperazine and phenyl-arginine-b-naphthylamide. J Antimicrob Chemother 5;2006;57(5). 970−4. PMID: 16531429.ArticlePubMed

Figure & Data

References

Citations

Citations to this article as recorded by  

• Types and Mechanisms of Efflux Pump Systems and the Potential of Efflux Pump Inhibitors in the Restoration of Antimicrobial Susceptibility, with a Special Reference to Acinetobacter baumannii
  Kira M. Zack, Trent Sorenson, Suresh G. Joshi
  Pathogens.2024; 13(3): 197.     CrossRef
• Association Between Drug Efflux Pumps and Resistance to Ciprofloxacin in Clinical Isolates of Acinetobacter baumannii
  Nour Amirmozafari, Azam Haddadi, Reza Mirnejad, Seyed Abdolhamid Angaji, Ebrahim Babapour
  Iranian Journal of Medical Microbiology.2024; 18(2): 113.     CrossRef
• Antimicrobial resistance genes harbored in invasive Acinetobacter calcoaceticus-baumannii complex isolated from Korean children during the pre-COVID-19 pandemic periods, 2015–2020
  Hyun Mi Kang, Kyung Ran Kim, Gahee Kim, Dong-gun Lee, Yae Jean Kim, Eun Hwa Choi, Jina Lee, Ki Wook Yun
  Frontiers in Cellular and Infection Microbiology.2024;[Epub]     CrossRef
• Navigating fluoroquinolone resistance in Gram-negative bacteria: a comprehensive evaluation
  Linda Kherroubi, Joanna Bacon, Khondaker Miraz Rahman
  JAC-Antimicrobial Resistance.2024;[Epub]     CrossRef
• Development of Nanoparticle Adaptation Phenomena in Acinetobacter baumannii: Physiological Change and Defense Response
  Oliver McNeilly, Riti Mann, Max Laurence Cummins, Steven P. Djordjevic, Mehrad Hamidian, Cindy Gunawan, Victor Gonzalez
  Microbiology Spectrum.2023;[Epub]     CrossRef
• Colistin potentiation in multidrug-resistant Acinetobacter baumannii by a non-cytotoxic guanidine derivative of silver
  Deepak Kumar, Chaitali Singhal, Manisha Yadav, Pooja Joshi, Priyanka Patra, Subhash Tanwar, Amitava Das, Sumit Kumar Pramanik, Susmita Chaudhuri
  Frontiers in Microbiology.2023;[Epub]     CrossRef
• Phenotypic and Molecular Characteristics of Carbapenem-Resistant Acinetobacter baumannii Isolates from Bulgarian Intensive Care Unit Patients
  Tanya V. Strateva, Ivo Sirakov, Temenuga J. Stoeva, Alexander Stratev, Slavil Peykov
  Microorganisms.2023; 11(4): 875.     CrossRef
• Effect of Phenylalanine–Arginine Beta-Naphthylamide on the Values of Minimum Inhibitory Concentration of Quinolones and Aminoglycosides in Clinical Isolates of Acinetobacter baumannii
  Stefany Plasencia-Rebata, Saul Levy-Blitchtein, Juana del Valle-Mendoza, Wilmer Silva-Caso, Isaac Peña-Tuesta, William Vicente Taboada, Fernando Barreda Bolaños, Miguel Angel Aguilar-Luis
  Antibiotics.2023; 12(6): 1071.     CrossRef
• How to treat severe Acinetobacter baumannii infections
  Emilio Bouza, Patricia Muñoz, Almudena Burillo
  Current Opinion in Infectious Diseases.2023; 36(6): 596.     CrossRef
• Comparative genotypic characterization related to antibiotic resistance phenotypes of clinical carbapenem-resistant Acinetobacter baumannii MTC1106 (ST2) and MTC0619 (ST25)
  Made Rai Dwitya Wiradiputra, Krit Thirapanmethee, Piyatip Khuntayaporn, Pagakrong Wanapaisan, Mullika Traidej Chomnawang
  BMC Genomics.2023;[Epub]     CrossRef
• A comprehensive review on potential therapeutic inhibitors of nosocomial Acinetobacter baumannii superbugs
  Danaboina Srikanth, Swanand Vinayak Joshi, Mahammad Ghouse Shaik, Gaurav Pawar, Sushmitha Bujji, Vinaykumar Kanchupalli, Sidharth Chopra, Srinivas Nanduri
  Bioorganic Chemistry.2022; 124: 105849.     CrossRef
• Differential Binding of Carbapenems with the AdeABC Efflux Pump and Modulation of the Expression of AdeB Linked to Novel Mutations within Two-Component System AdeRS in Carbapenem-Resistant Acinetobacter baumannii
  Subhasree Roy, Vivek Junghare, Shanta Dutta, Saugata Hazra, Sulagna Basu, Christopher W. Marshall
  mSystems.2022;[Epub]     CrossRef
• Antimicrobial Resistance, Integron Carriage, and Fluoroquinolone Resistance Genes in Acinetobacte baumannii Isolates
  Parastoo Ashouri, Jafar Mohammadshahi, Vajihe Sadat Nikbin, Hadi Peeridogaheh, Behnam Mohammadi-Ghalehbin, Soheila Refahi, Amir Teimourpour, Majid Esmaelizad, Hafez Mirzaneghad, Roghayeh Teimourpour
  Archives of Clinical Infectious Diseases.2022;[Epub]     CrossRef
• Efflux pumps in multidrug-resistant Acinetobacter baumannii: Current status and challenges in the discovery of efflux pumps inhibitors
  Privita Verma, Monalisa Tiwari, Vishvanath Tiwari
  Microbial Pathogenesis.2021; 152: 104766.     CrossRef
• Overexpression of Efflux Pumps, Mutations in the Pumps’ Regulators, Chromosomal Mutations, and AAC(6′)-Ib-cr Are Associated With Fluoroquinolone Resistance in Diverse Sequence Types of Neonatal Septicaemic Acinetobacter baumannii: A 7-Year Single Center S
  Subhasree Roy, Somdatta Chatterjee, Amrita Bhattacharjee, Pinaki Chattopadhyay, Bijan Saha, Shanta Dutta, Sulagna Basu
  Frontiers in Microbiology.2021;[Epub]     CrossRef
• Shared and Unique Evolutionary Trajectories to Ciprofloxacin Resistance in Gram-Negative Bacterial Pathogens
  Jaime E. Zlamal, Semen A. Leyn, Mallika Iyer, Marinela L. Elane, Nicholas A. Wong, James W. Wamsley, Maarten Vercruysse, Fernando Garcia-Alcalde, Andrei L. Osterman, Igor B. Zhulin
  mBio.2021;[Epub]     CrossRef
• Efflux Pump Activity and Mutations Driving Multidrug Resistance in Acinetobacter baumannii at a Tertiary Hospital in Pretoria, South Africa
  Noel-David Nogbou, Granny M. Nkawane, Khanyisa Ntshane, Charles K. Wairuri, Dikwata T. Phofa, Kagiso K. Mokgokong, Mbudzeni Ramashia, Maphoshane Nchabeleng, Lawrence C. Obi, Andrew M. Musyoki, Todd R. Callaway
  International Journal of Microbiology.2021; 2021: 1.     CrossRef
• The effect of the efflux pump inhibitor Carbonyl Cyanide m-Chlorophenylhydrazone (CCCP) on the susceptibility to imipenem and cefepime in clinical strains of Acinetobacter baumannii
  Alejandra Sanchez-Carbonel, Belén Mondragón, Nicolás López-Chegne, Isaac Peña-Tuesta, Gladys Huayan-Dávila, Dora Blitchtein, Hugo Carrillo-Ng, Wilmer Silva-Caso, Miguel Angel Aguilar-Luis, Juana del Valle-Mendoza, Iddya Karunasagar
  PLOS ONE.2021; 16(12): e0259915.     CrossRef
• Effects of different resistance mechanisms on antimicrobial resistance in Acinetobacter baumannii: a strategic system for screening and activity testing of new antibiotics
  Yu-Kuo Tsai, Ci-Hong Liou, Jung-Chung Lin, Chang-Phone Fung, Feng-Yee Chang, L. Kristopher Siu
  International Journal of Antimicrobial Agents.2020; 55(4): 105918.     CrossRef
• Antibiotic Resistance Profiles, Molecular Mechanisms and Innovative Treatment Strategies of Acinetobacter baumannii
  Corneliu Ovidiu Vrancianu, Irina Gheorghe, Ilda Barbu Czobor, Mariana Carmen Chifiriuc
  Microorganisms.2020; 8(6): 935.     CrossRef
• Bacterial Genome Wide Association Studies (bGWAS) and Transcriptomics Identifies Cryptic Antimicrobial Resistance Mechanisms in Acinetobacter baumannii
  Chandler Roe, Charles H. D. Williamson, Adam J. Vazquez, Kristen Kyger, Michael Valentine, Jolene R. Bowers, Paul D. Phillips, Veronica Harrison, Elizabeth Driebe, David M. Engelthaler, Jason W. Sahl
  Frontiers in Public Health.2020;[Epub]     CrossRef
• Molecular Analyses of Biofilm-Producing Clinical Acinetobacter baumannii Isolates from a South Indian Tertiary Care Hospital
  Balaram Khamari, Manmath Lama, Chanakya Pachi Pulusu, Amarendra Pratap  Biswal, Sai Manoz Lingamallu, Bhargava Sai Mukkirla, Amit Kumar Sahoo, Harioum Sambhu Narayan Dash, Rewa Sharda, Prakash Kumar, Eswarappa Pradeep Bulagonda
  Medical Principles and Practice.2020; 29(6): 580.     CrossRef
• Using WGS to identify antibiotic resistance genes and predict antimicrobial resistance phenotypes in MDR Acinetobacter baumannii in Tanzania
  Happiness H Kumburu, Tolbert Sonda, Marco van Zwetselaar, Pimlapas Leekitcharoenphon, Oksana Lukjancenko, Blandina T Mmbaga, Michael Alifrangis, Ole Lund, Frank M Aarestrup, Gibson S Kibiki
  Journal of Antimicrobial Chemotherapy.2019; 74(6): 1484.     CrossRef
• Phenotypic and Genotypic Characterization of Acinetobacter spp. Panel Strains: A Cornerstone to Facilitate Antimicrobial Development
  Roshan D'Souza, Naina A. Pinto, Nguyen Le Phuong, Paul G. Higgins, Thao Nguyen Vu, Jung-Hyun Byun, Young Lag Cho, Jong Rak Choi, Dongeun Yong
  Frontiers in Microbiology.2019;[Epub]     CrossRef
• Multidrug Resistant Acinetobacter baumannii: Resistance by Any Other Name Would Still be Hard to Treat
  David A. Butler, Mark Biagi, Xing Tan, Samah Qasmieh, Zackery P. Bulman, Eric Wenzler
  Current Infectious Disease Reports.2019;[Epub]     CrossRef
• Molecular Study of Quinolone Resistance Determining Regions of gyrA Gene and parC Genes in Clinical Isolates of Acintobacter baumannii Resistant to Fluoroquinolone
  Maysaa El Sayed Zaki, Nermen Abou ElKheir, Mohamed Mofreh
  The Open Microbiology Journal.2018; 12(1): 116.     CrossRef
• Species distribution, virulence factors and antimicrobial resistance of Acinetobacter spp. isolates from dogs and cats: a preliminary study
  Yui Kimura, Kazuki Harada, Takae Shimizu, Tomomi Sato, Akari Kajino, Masaru Usui, Yutaka Tamura, Yuzo Tsuyuki, Tadashi Miyamoto, Asami Ohki, Masahisa Watarai
  Microbiology and Immunology.2018; 62(7): 462.     CrossRef
• Multiple mechanisms contributing to ciprofloxacin resistance among Gram negative bacteria causing infections to cancer patients
  Samira M. Hamed, Walid F. Elkhatib, Hadir A. El-Mahallawy, Mai M. Helmy, Mohamed S. Ashour, Khaled M. A. Aboshanab
  Scientific Reports.2018;[Epub]     CrossRef
• Synthesis and investigation of binding interactions of 1,4-benzoxazine derivatives on topoisomerase IV in Acinetobacter baumannii
  S. Yilmaz, I. Yalcin, S. Okten, F. K. Onurdag, E. Aki-Yalcin
  SAR and QSAR in Environmental Research.2017; 28(11): 941.     CrossRef
• Antibacterial Resistance in Ureaplasma Species and Mycoplasma hominis Isolates from Urine Cultures in College-Aged Females
  Marissa A. Valentine-King, Mary B. Brown
  Antimicrobial Agents and Chemotherapy.2017;[Epub]     CrossRef
• MOLECULAR BACKGROUND OF FLUOROQUINOLONE RESISTANCE IN PATHOGENIC HUMAN MYCOPLASMAS
  A. N. Vaganova
  Russian Journal of Infection and Immunity.2017; 7(3): 231.     CrossRef
• Alarmingly High Segregation Frequencies of Quinolone Resistance Alleles within Human and Animal Microbiomes Are Not Explained by Direct Clinical Antibiotic Exposure
  Wesley Field, Ruth Hershberg
  Genome Biology and Evolution.2015; 7(6): 1743.     CrossRef
• Multidrug-resistant Acinetobactor baumannii isolated from a traveler returned from Brunei
  Masayoshi Tojo, Momoko Mawatari, Kayoko Hayakawa, Maki Nagamatsu, Kayo Shimada, Kazuhisa Mezaki, Yuko Sugiki, Emi Kuroda, Nozomi Takeshita, Satoshi Kutsuna, Yoshihiro Fujiya, Tohru Miyoshi-Akiyama, Teruo Kirikae, Norio Ohmagari
  Journal of Infection and Chemotherapy.2015; 21(3): 212.     CrossRef
• Correlation of Ciprofloxacin Resistance with the AdeABC Efflux System in Acinetobacter baumannii Clinical Isolates
  Abdollah Ardebili, Abdolaziz Rastegar Lari, Malihe Talebi
  Annals of Laboratory Medicine.2014; 34(6): 433.     CrossRef
• Effect of Efflux Pump Inhibitor Carbonyl Cyanide 3-Chlorophenylhydrazone on the Minimum Inhibitory Concentration of Ciprofloxacin in Acinetobacter baumannii Clinical Isolates
  Abdollah Ardebili, Malihe Talebi, Leila Azimi, Abdolaziz Rastegar Lari
  Jundishapur Journal of Microbiology.2014;[Epub]     CrossRef
• Characterization of Acinetobacter baumannii Clinical Isolates Carrying blaOXA-23 Carbapenemase and 16S rRNA Methylase armA genes in Yemen
  Sofiane Bakour, Samer Ahmed Alsharapy, Abdelaziz Touati, Jean-Marc Rolain
  Microbial Drug Resistance.2014; 20(6): 604.     CrossRef
• First report of 16S rRNA methylase ArmA-producing Acinetobacter baumannii and rapid spread of metallo-β-lactamase NDM-1 in Algerian hospitals
  Sofiane Bakour, Abdelaziz Touati, Taous Bachiri, Farida Sahli, Djamel Tiouit, Malek Naim, Mounia Azouaou, Jean-Marc Rolain
  Journal of Infection and Chemotherapy.2014; 20(11): 696.     CrossRef