Deletion of the
mdfA gene was performed by the method described by Datsenko and Wanner
[5]. The kanamycin resistance gene kan flanked by flippase (FLP) recognition target sites was amplified by a standard polymerase chain reaction (PCR) with the templated plasmid pKD4 and hybrid primers. These primers, P1MdfA (AGCTGCGCTTTATTAAACTCTG CGCGATTA TTATTGGCGAAGAAATTGCGTGTA GGCTGGAGCTGCTTC) and P2MdfA (TCACCATT AATTCGAGAATGCCTGATCGCACAAATCAATCA GGCATTTTTATGGGAATTAGCCATGGTCC), were synthesized with 20 nucleotides (nt) of priming sites 1 and 2 of pKD4 and with 50 nt of the 5' and 3' ends of the
mdfA gene. The 1.6 kb PCR fragment was purified and electroporated into
S flexneri isolates, 021787 and 021895, into which the red recombinase expression plasmid pKD46 was introduced. Transformants were selected at 37℃ on Luria–Bertani (LB) agar medium containing kanamycin at 50 ug/ml. Homologous recombination between the genomic DNA and the PCR product resulted in the deletion of the
mdfA sequence from nt –50 to 1327 (1,377-bp deletion) and its replacement with the
kan gene. This was confirmed by two different PCRs. Deletion of
mdfA in the transformants was first shown by PCR with primers MdfA3 (GCTGCGCTTTTATTAAACTCTGC) and MdfA4 (CCTGATCGCACAAATCATCA G), whose sequences correspond to sequences flanking the
mdfA deletion and that resulted in a 1,227-bp fragment for the parental strains and a negative result when
mdfA was deleted and replaced by the
kan gene flanked by FLP. The third control PCR, with primers k2 (CGGTGCCCTGAAT GAACTGC) and kt (CGGCCACAGTCGATGAATCC), was used to detect the 471-bp
kan fragment.