Figure 1Intracellular localization of Brucella abortus wild-type and lon mutant in J774.A1 cells. The J774.A1 cells infected with B. abortus wild-type (upper panel) or lon mutant (lower panel) for 6 hours were fixed and stained with an antibody directed against Brucella in the same field. The results were evaluated by bright-field photomicrographs (A and D), fluorescein isothiocyanate (FITC) filter (B and E), and Hoechst staining (C and F) for nuclei. All panels, ×400.
Figure 2The messenger RNA expression of tumor necrosis factor (TNF)-α during early infection. The level of TNF-α was determined from the J774.A1 cells infected with Brucella abortus, wild-type Brucella, or the lon mutant [multiplicity of infection (MOI) = 50] by reverse transcriptase-polymerase chain reaction.
Figure 3The protein expression of tumor necrosis factor (TNF)-α during early infection. The level of TNF-α was determined from the medium of J774.A1 cells infected with Brucella abortus, wild-type Brucella, or the lon mutant [multiplicity of infection (MOI) = 50] using enzyme-linked immunosorbent assay.
Table 1Primers for reverse transcriptase-polymerase chain reaction used in this study
Primer name |
Primer sequence (5'-3') |
β2-microglobulin-F |
GGCTCGCTCGGTGACCCTAGTCTTT |
β2-microglobulin-R |
TCTGCAGGCGTATGTATCAGTCTCA |
TNF-α-F |
AGCCCACGTCGTAGCAAACCACCAA |
TNF-α-R |
ACACCCATTCCCTTCACAGAGCAAT |
Table 2Messenger RNA expression of upregulated cytokine genes during lon mutant infection between 6 hours and 24 hours postinfection
Normalized fold |
Accession number |
Gene symbol |
Description |
6 h |
11.23 |
NM_021274 |
Cxcl10 |
Chemokine ligand 10 |
6.61 |
NM_013693 |
Tnf |
Tumor necrosis factor |
5.52 |
NM_008352 |
IL2b |
Interleukin 12b |
5.27 |
NM_009425 |
Tnfefl0 |
Tumor necrosis factor superfamily, member 10 |
4.47 |
NM_010510 |
Ifnb1 |
Interferon beta 1 |
3.69 |
NM_011577 |
Tgfb1 |
Transforming growth factor, beta 1 |
12 h |
7.9 |
NM_021274 |
Cxcl10 |
Chemokine ligand 10 |
7.78 |
NM_009399 |
Tnfrsf11a |
Tumor necrosis factor receptor superfamily, member 11a |
6.81 |
NM_013653 |
Ccl5 |
Chemokine ligand 5 |
4.21 |
NM_010554 |
Il1a |
Interleukin 1 α |
3.8 |
NM_011577 |
Tgfb1 |
Transforming growth factor, beta 1 |
3.18 |
NM_009425 |
Tgfsf10 |
Tumor necrosis factor superfamily, member 10 |
3.08 |
NM_028679 |
Irak3 |
Interleukin-1 receptor-associated kinase 3 |
3.07 |
AK156231 |
Ccnt2 |
Cyclin T2 |
24 h |
5.44 |
NM_197889 |
Ifnz |
Interferon zeta |
5.16 |
NM_009425 |
Tnfsf10 |
Tumor necrosis factor superfamily, member 10 |
4.57 |
NM_013653 |
Ccl5 |
Chemokine ligand 5 |
4.25 |
NM_008003 |
Fgf15 |
Fibroblast growth factor 15 |
3.68 |
NM_016673 |
Cntfr |
Ciliary neurotrophic factor receptor |
3.54 |
NM_021274 |
Cxcl10 |
Chemokine ligand 10 |
3.36 |
NM_011888 |
Ccl19 |
Chemokine ligand 19 |
3.35 |
NM_011577 |
Tgfb1 |
Transforming growth factor, beta 1 |
3.31 |
NM_021887 |
Il21r |
Interleukin 21 receptor |
3.26 |
NM_009399 |
Tnfrsf11a |
Tumor necrosis factor receptor superfamily, member 11a |