Skip Navigation
Skip to contents

PHRP : Osong Public Health and Research Perspectives

OPEN ACCESS
SEARCH
Search

Articles

Page Path
HOME > Osong Public Health Res Perspect > Volume 7(5); 2016 > Article
Original Article
Plasmid-Mediated Quinolone-Resistance (qnr) Genes in Clinical Isolates of Escherichia coli Collected from Several Hospitals of Qazvin and Zanjan Provinces, Iran
Maryam Rezazadeha, Hamid Baghchesaraeia, Amir Peymanib
Osong Public Health and Research Perspectives 2016;7(5):307-312.
DOI: https://doi.org/10.1016/j.phrp.2016.08.003
Published online: August 24, 2016

aDepartment of Microbiology, Faculty of Medicine, Zanjan University of Medical Sciences, Zanjan, Iran

bMedical Microbiology Research Center, Qazvin University of Medical Sciences, Qazvin, Iran

∗Corresponding author. a.peymani@gmail.com
• Received: June 21, 2016   • Revised: August 2, 2016   • Accepted: August 17, 2016

© 2016 Korea Centers for Disease Control and Prevention. Published by Elsevier Korea LLC.

This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

  • 3,500 Views
  • 32 Download
  • 31 Crossref
  • 43 Scopus
prev next
  • Objectives
    Escherichia coli is regarded as the most important etiological agent of urinary tract infections. Fluoroquinolones are routinely used in the treatment of these infections; however, in recent years, a growing rate of resistance to these drugs has been reported globally. The aims of this study were to detect plasmid-mediated qnrA, qnrB, and qnrS genes among the quinolone-nonsusceptible E. coli isolates and to investigate their clonal relatedness in Qazvin and Zanjan Provinces, Iran.
  • Methods
    A total of 200 clinical isolates of E. coli were collected from hospitalized patients. The bacterial isolates were identified through standard laboratory protocols and further confirmed using API 20E test strips. Antimicrobial susceptibility was determined by the standard disk diffusion method. Polymerase chain reaction (PCR) and sequencing were used for detecting qnrA, qnrB, and qnrS genes and the clonal relatedness of qnr-positive isolates was evaluated by enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR) method.
  • Results
    In total, 136 (68%) isolates were nonsusceptible to quinolone compounds, among which 45 (33.1%) and 71 (52.2%) isolates showed high- and low-level quinolone resistance, respectively. Of the 136 isolates, four (2.9%) isolates were positive for the qnrS1 gene. The results from ERIC-PCR revealed that two (50%) cases of qnr-positive isolates were related genetically.
  • Conclusion
    Our study results were indicative of the presence of low frequency of qnr genes among the clinical isolates of E. coli in Qazvin and Zanjan Provinces, which emphasizes the need for establishing tactful policies associated with infection-control measures in our hospital settings.
Clinically, Escherichia coli is an important Gram-negative bacteria with the potential to cause serious disease including urinary tract infections (UTIs), pyelonephritis, and bacteremia [1]. UTIs, known as the most common hospital-acquired infections, account for up to 35% of infections associated with health-care system and E. coli is reported to be the most frequent cause of UTIs [2]. Fluoroquinolones are synthetic and broad-spectrum antibacterial agents often used for the treatment of lower UTIs [3]. Inappropriate and unnecessary administration of these antibiotics has led to an increase in the appearance of multidrug-resistant E. coli isolates, limiting treatment options. Serious health-care-associated infections caused by these resistant organisms have been associated with considerable morbidity and mortality [4].
Fluoroquinolones inhibit two bacterial enzymes, DNA gyrase and topoisomerase IV, both of which play essential roles in bacterial DNA replication [5]. Resistance to quinolone is often linked to amino acid substitutions in the quinolone-resistance-determining regions of DNA gyrase (gyrA and gyrB) and DNA topoisomerase IV (parC and parE) subunits, leading to target modification [6]. Decreased outer membrane permeability through porin changes and overexpression of naturally occurring efflux systems may also contribute to chromosomal quinolone resistance [7]. However, recent reports indicate that quinolone resistance can also be mediated by mobile genetic elements such as plasmids. Plasmid-mediated quinolone resistance is mediated by the genes (qnr) encoding proteins that belong to the pentapeptide repeat family and protect DNA gyrase and topoisomerase IV against quinolone compounds [8]. The three major groups of qnr determinants are qnrA, qnrB, and qnrS 9, 10. The first plasmid-mediated quinolone-resistance gene (qnrA) was identified in a clinical strain of Klebsiella pneumoniae isolated in Alabama in 1998 [11]. The other two determinants of qnr (qnrB and qnrS) have subsequently been observed in other enterobacterial species including E. coli, Enterobacter spp., Salmonella spp., and Klebsiella pneumonia [12].
Plasmid-mediated resistance is of growing clinical concern as they may transfer resistance genes to other species via horizontal gene transfer, conferring resistance against these antibiotics [13]. Moreover, the simultaneous presence of extended-spectrum beta-lactamases (ESBLs), AmpC, and qnr genes on the same plasmid has been well documented and this highlights the complexity of determinants involved in plasmid-mediated resistance among the enterobacterial isolates in medical settings [14]. Obviously, the widespread appearance of a growing trend associated with the prevalence of plasmid-mediated resistance among enterobacterial isolates is undeniable; however, only limited numbers of studies have been reported from Iran addressing the prevalence of qnr genes among the clinical isolates of E. coli. The aim of this study was, therefore, to investigate the presence of qnr determinants among E. coli isolates collected from a number of hospitals in two Iranian provinces—Zanjan and Qazvin.
2.1 Study design and bacterial isolates
In this cross-sectional study, 200 nonrepetitive E. coli isolates were obtained from the clinical sample of UTI patients admitted to hospitals in Zanjan (1 hospital) and Qazvin (3 hospitals) between July 2014 and December 2015. The organisms were identified by standard laboratory methods and later confirmed using the API 20 E test strips (bioMérieux, Marcy l'Etoile, France). The isolates were stored at −70°C in Trypticase soy broth containing 20% glycerol and subcultured two times prior to testing. The mean age of patients was 50.47 ± 18.8 years (range, 13–85 years). There were 153 (76.5%) female and 47 (23.5%) male patients.
2.2 Antimicrobial susceptibility
The Kirby–Bauer disk diffusion method was performed according to the Clinical Laboratory Standards Institute guidelines [15] to detect quinolone-resistance phenotype using nalidixic acid (10 μg), ciprofloxacin (5 μg), gatifloxacin (5 μg), norfloxacin (10 μg), levofloxacin (5 μg), imipenem (10 μg), and meropenem (10 μg) disks. If the results of antibiotic-susceptibility test confirmed the presence of resistance to both ciprofloxacin and nalidixic acid, the isolates were marked as high-level quinolone-resistant bacteria, whereas nalidixic acid-resistant or intermediate isolates and ciprofloxacin-susceptible isolates were marked as low-level quinolone-resistant bacteria [16]. Antibiotic disks were purchased from Mast Company (Mast Diagnostics Group Ltd, Merseyside, UK). E. coli American Type Culture Collection (ATCC) 25922 and Pseudomonas aeruginosa ATCC 27853 were used as quality-control strains in antimicrobial susceptibility testing.
2.3 DNA extraction and detection of qnr-encoding genes
The detection of qnrA, qnrB, and qnrS plasmid-mediated quinolone-resistance genes was performed using polymerase chain reaction (PCR) and specific primers (Table 1) [17]. Plasmid DNA was extracted using plasmid mini-extraction kit (Bioneer, Daejeon, South Korea). PCR amplifications were performed in a thermocycler (Applied Biosystems, USA) as follows: 95°C for 5 minutes and 35 cycles of 1 minute at 95°C, 1 minute at specific annealing temperature for each primer, and 1 minute at 72°C. A final extension step of 10 minutes at 72°C was performed. Amplification reactions were prepared in a total volume of 25 μL (24 μL of PCR master mix plus 1 μL of template DNA) including 5 ng of genomic DNA, 2.0 U of Taq DNA polymerase (Fermentas, Vilnius, Lithuania), 10mM deoxyribose nucleoside triphosphate mix at a final concentration of 0.2mM, 50mM MgCl2 at a final concentration of 1.5mM, 1μM of each primer, and 1× PCR buffer (final concentration). PCR products were electrophoresed on 1% agarose gel at 100 V and stained with ethidium bromide solution and finally visualized in gel documentation system (UVItec Limited, Cambridge, UK).
2.4 Clonal analysis of qnr-positive isolates
All qnr-positive E. coli isolates were tested for epidemiological relationships using enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR) as previously described by Smith et al [18]. PCR cycling conditions were as follows: denaturation at 94°C for 1 second, annealing at 52°C for 10 seconds, and extension at 72°C for 35 seconds for 30 cycles, followed by a final extension at 72°C for 4 minutes. The final products were electrophoresed on 1.5% agarose gels. Visual comparison was employed to examine the fingerprints, and the patterns varying by two or more bands were classified as different.
2.5 Statistical analysis
Statistical data analysis was performed for descriptive statistics including frequencies, cross tabulation of microbiological and clinical features, and demographic characteristics using the computer software program SPSS version 16 (SPSS Inc., Chicago, IL, USA).
3.1 Resistance to quinolone compounds
A total of 200 E. coli isolates were obtained from patients admitted to internal medicine (82; 41%), intensive care unit (52; 26%), infectious diseases (49; 24.5%), surgery (11; 5.5%), and neurosurgery (6; 3%) wards. According to the results of the disk diffusion method, the highest resistance rate of isolates was against nalidixic acid (67.5%) and gatifloxacin (58%), whereas 44.5% and 44% of isolates demonstrated the highest rate of susceptibility to norfloxacin and ciprofloxacin, respectively. Overall, 136 (68%) isolates were nonsusceptible to quinolone compounds used in this study. High-level quinolone resistance was found in 45 (33.1%) isolates, and 71 (52.2%) bacterial samples revealed low-level quinolone resistance. In total, 93% and 91% of isolates were sensitive to meropenem and imipenem, respectively (Table 2).
3.2 Presence of qnr-encoding genes
PCR and sequencing showed that four (2.9%) of the 136 quinolone-nonsusceptible E. coli isolates carried qnrS1. The qnrA and qnrB genes were not found among the clinical isolates of this study. As shown in Table 3, qnrS1-positive isolates were mostly isolated from the internal medicine wards. Three of four (75%) isolates showed high quinolone-resistance level.
3.3 Clonal relatedness of qnr-positive isolates
The results obtained by ERIC-PCR were indicative of the presence of two (50%) qnr-positive E. coli clinical strains isolated from Zanjan hospital with similar ERIC-PCR patterns but, as shown in Figure 1, with a genotypic pattern unrelated to the two isolates collected from Qazvin hospitals.
UTIs are the commonest type of bacterial infections and E. coli is the most prevalent cause of UTIs [1]. Quinolones are the most widely used antibacterial agents in fighting against serious infections caused by E. coli and other members of Enterobacteriaceae in Iran [19]. However, plasmid-mediated quinolone resistance in the genus belonging to Enterobacteriaceae, especially E. coil, has led to treatment failures and currently is becoming a significant public health concern. Plasmid-mediated resistance to quinolones is being increasingly reported in studies from Asia, Europe, Australia, and the United States [20]. However, the number of reports on prevalence of qnr genes among Iranian enterobacterial isolates is only limited to few studies.
This study showed a high level of antimicrobial resistance against quinolone compounds among urinary E. coli isolates. Overall, 67.5% and 56% of isolates were either fully resistant or had intermediate resistance to nalidixic acid and ciprofloxacin, respectively. Our results were partly similar to the resistance levels reported in two previously conducted studies in Iran. Firoozeh et al [19] reported that 82.5% and 45% of urinary E. coli isolates were resistant to nalidixic acid and ciprofloxacin, respectively. In another study from Iran, Khorvash et al [21] found that 76% and 52% E. coli isolates associated with nosocomial infection were resistant to nalidixic acid and ciprofloxacin, respectively. In our neighboring country, Pakistan, Muhammad et al [22] showed that 84.2% and 36.5% of E. coli isolated from UTIs were resistant to nalidixic acid and ciprofloxacin, respectively. In China, the frequency of ciprofloxacin resistance among the urinary E. coli isolates was 59.4% [23]. It seems that unnecessary and widespread administration of these antibacterial agents is the most important predisposing factor that could eventually lead to appearance of resistant bacteria in our hospital settings. Moreover, the resistance rate found in this study emphasizes the need for a local and national antimicrobial resistance surveillance system in bacterial isolates present in our hospital settings.
In this study, meropenem and imipenem showed high-level susceptibility against E. coli infections. Currently, the treatment of infections caused by multidrug resistant Gram-negative bacteria is achieved by administration of carbapenems as the drugs of choice; however, in this study, 9% and 7% of isolates were either fully resistant or had intermediate susceptibility to imipenem and meropenem, respectively, a finding that would have more clinical impact if these strains become more prevalent in the future.
This study demonstrated a low prevalence rate (2.9%) of plasmid-mediated quinolone resistance (qnrS1) among quinolone-nonsusceptible E. coli isolates in educational hospitals of Qazvin and Zanjan Provinces. We did not find the qnrA and qnrB genes in our clinical isolates. The frequency of qnr genes in our study was lower than those found in the two studies previously conducted in Iran. In a study from Khorramabad (Iran), Firoozeh et al reported that 14 (12.1%) and nine (7.8%) nalidixic acid-resistant E. coli isolates were positive for qnrA and qnrB genes, respectively [19]. In another study from Tehran, Pakzad et al [24] showed that qnrA and qnrB genes were present in 37.5% and 20.8% of ESBL-producing E. coli isolates, respectively. Like our study, a low frequency for qnr gene isolation was also described by other reports. In Brazil, Pereira et al [25] reported that only a single E. coli isolate among 144 ciprofloxacin-resistant isolates was positive for qnr genes. In Singapore, Deepak et al [26] also showed that 1.8% of urinary isolates of E. coli were found to possess the qnrS gene.
In Denmark, Cavaco et al [27] showed only 1.6% of nalidixic acid-resistant E. coli isolates as qnr positive. In France, qnr genes were present in 1.6% of ESBL-producing E. coli and Klebsiella spp. isolates [28]. In Canada, only about 1% of ciprofloxacin- and/or tobramycin-resistant E. coli and Klebsiella spp. isolates were qnr positive [29]. Nevertheless, the high prevalence rate of qnr genes has also been detected in Egypt where 26.6% of ESBL-producing E. coli isolates were positive for qnr genes, among which qnrA1-, qnrB1-, and qnrS1-type genes were detected alone or in combination in 16.6%, 23.3%, and 16.6% isolates, respectively [30]. We previously showed the high appearance of qnrB1, qnrS1, and qnrB4 genes among the clinical isolates of K. pneumoniae in Iran [31].
In this study, most qnr-positive isolates showed high-level resistance. Because qnr genes are responsible for low-level resistance to quinolones, it can be hypothesized that high-level resistance pattern could be linked to the presence of other mechanisms such as secondary changes in DNA gyrase or topoisomerase IV, and porin or efflux systems, which was not evaluated in our study.
In this work, the ERIC-PCR analysis of two qnr-positive isolates from Qazvin confirmed that these two isolates were epidemiologically unrelated; the explanation for this finding may be attributed to the fact that the clinical isolates from Qazvin were collected from two different hospitals, whereas those obtained from Zanjan were collected from the same hospital, resulting in identical genetic profile.
In conclusion, results of this study revealed the low prevalence rate of plasmid-mediated quinolone resistance associated with the presence of qnr genes among the clinical isolates of E. coli in Qazvin and Zanjan Provinces, Iran. The appearance of quinolone resistance through this type of mechanism within the Iranian health-care system could produce serious therapeutic and epidemiological concerns, which can be overcome through establishing appropriate infection control measures as well as comprehensive guidelines on proper administration of antibacterial in our medical centers.
The authors declare no conflicts of interest.
Acknowledgements
The authors would like to appreciate the acting head and also other staff of the Cellular and Molecular Research Center, Qazvin University of Medical Sciences for their assistance to complete this research project.
  • 1. Jacobsen S.M., Stickler D.J., Mobley H.L.. Complicated catheter-associated urinary tract infections due to Escherichia coli and Proteus mirabilis. Clin Microbiol Rev 21(1). 2008 Jan;26−59. PMID: 18202436.ArticlePubMed
  • 2. Wilson M.L., Gaido L.. Laboratory diagnosis of urinary tract infections in adult patients. Clin Infect Dis 39(6). 2004 Sep 15;873−874. PMID: 15472825.Article
  • 3. Da Silva A.D., De Almeida M.V., De Souza M.V.. Biological activity and synthetic metodologies for the preparation of fluoroquinolones, a class of potent antibacterial agents. Curr Med Chem 10(1). 2003 Jan;21−39. PMID: 12570719.ArticlePubMed
  • 4. de Kraker M.E., Davey P.G., Grundmann H.. Mortality and hospital stay associated with resistant Staphylococcus aureus and Escherichia coli bacteremia: estimating the burden of antibiotic resistance in Europe. PLoS Med 8(10). 2011 Oct;e1001104PMID: 22022233.ArticlePubMed
  • 5. Hooper D.C.. Mechanisms of action and resistance of older and newer fluoroquinolones. Clin Infect Dis 31(Suppl 2). 2000 Aug;S24−S28. PMID: 10984324.ArticlePubMed
  • 6. Komp Lindgren P., Karlsson A., Hughes D.. Mutation rate and evolution of fluoroquinolone resistance in Escherichia coli isolates from patients with urinary tract infections. Antimicrob Agents Chemother 47(10). 2003 Oct;3222−3232. PMID: 14506034.ArticlePubMed
  • 7. Fernández L., Hancock R.E.. Adaptive and mutational resistance: role of porins and efflux pumps in drug resistance. Clin Microbiol Rev 25(4). 2012 Oct;661−681. PMID: 23034325.ArticlePubMed
  • 8. Strahilevitz J., Jacoby G.A., Hooper D.C.. Plasmid-mediated quinolone resistance: a multifaceted threat. Clin Microbiol Rev 22(4). 2009 Oct;664−689. PMID: 19822894.ArticlePubMed
  • 9. Kim H.B., Park C.H., Kim C.J.. Prevalence of plasmid-mediated quinolone resistance determinants over a 9-year period. Antimicrob Agents Chemother 53(2). 2009 Feb;639−645. PMID: 19064896.ArticlePubMed
  • 10. Minarini L.A., Poirel L., Cattoir V.. Plasmid-mediated quinolone resistance determinants among enterobacterial isolates from outpatients in Brazil. J Antimicrob Chemother 62(3). 2008 Sep;474−478. PMID: 18552340.ArticlePubMed
  • 11. Mammeri H., Van De Loo M., Poirel L.. Emergence of plasmid-mediated quinolone resistance in Escherichia coli in Europe. Antimicrob Agents Chemother 49(1). 2005 Jan;71−76. PMID: 15616277.ArticlePubMed
  • 12. Andres P., Lucero C., Soler-Bistué A.. Differential distribution of plasmid-mediated quinolone resistance genes in clinical enterobacteria with unusual phenotypes of quinolone susceptibility from Argentina. Antimicrob Agents Chemother 57(6). 2013 Jun;2467−2475. PMID: 23478955.ArticlePubMed
  • 13. Davies J., Davies D.. Origins and evolution of antibiotic resistance. Microbiol Mol Biol Rev 74(3). 2010 Sep;417−433. PMID: 20805405.ArticlePubMed
  • 14. Rawat D., Nair D.. Extended-spectrum β-lactamases in Gram negative bacteria. J Glob Infect Dis 2(3). 2010 Sep;263−274. PMID: 20927289.ArticlePubMed
  • 15. Clinical and Laboratory Standards Institute . Performance standards for antimicrobial susceptibility testing. 23th informational supplement (M100-S23). 2013. Clinical and Laboratory Standards; Wayne, PA.
  • 16. Oktem I.M., Gulay Z., Bicmen M.. qnrA prevalence in extended-spectrum beta-lactamase-positive Enterobacteriaceae isolates from Turkey. Jpn J Infect Dis 61(1). 2008 Jan;13−17. PMID: 18219128.ArticlePubMed
  • 17. Lavilla S., González-López J.J., Sabaté M.. Prevalence of qnr genes among extended-spectrum beta-lactamase-producing enterobacterial isolates in Barcelona, Spain. J Antimicrob Chemother 61(2). 2008 Feb;291−295. PMID: 18029415.ArticlePubMed
  • 18. Smith J.L., Drum D.J., Dai Y.. Impact of antimicrobial usage on antimicrobial resistance in commensal Escherichia coli strains colonizing broiler chickens. Appl Environ Microbiol 73(5). 2007 Mar;1404−1414. PMID: 17194843.ArticlePubMed
  • 19. Firoozeh F., Zibaei M., Soleimani-Asl Y.. Detection of plasmid-mediated qnr genes among the quinolone-resistant Escherichia coli isolates in Iran. J Infect Dev Ctries 8(7). 2014 Jul 14;818−822. PMID: 25022290.Article
  • 20. Dalhoff A.. Global fluoroquinolone resistance epidemiology and implictions for clinical use. Interdiscip Perspect Infect Dis 2012:2012;976273PMID: 23097666.ArticlePubMedPMC
  • 21. Khorvash F., Mostafavizadeh K., Mobasherizadeh S.. Susceptibility pattern of E. coli-associated urinary tract infection (UTI): a comparison of spinal cord injury-related and nosocomial UTI. Med Sci Monit 15(11). 2009 Nov;CR579−CR582. PMID: 19865057.PubMed
  • 22. Muhammad I., Uzma M., Yasmin B.. Prevalence of antimicrobial resistance and integrons in Escherichia coli from Punjab, Pakistan. Braz J Microbiol 42(2). 2011 Apr;462−466. PMID: 24031655.ArticlePubMed
  • 23. Shao H.F., Wang W.P., Zhang X.W.. Distribution and resistance trends of pathogens from urinary tract infections and impact on management. Zhonghua Nan Ke Xue 9(9). 2003 Dec;690−692, 696. [in Chinese]. PMID: 14727361.PubMed
  • 24. Pakzad I., Ghafourian S., Taherikalani M.. qnr prevalence in extended spectrum beta-lactamases (ESBLs) and none-ESBLs producing Escherichia coli isolated from urinary tract infections in central of Iran. Iran J Basic Med Sci 14(5). 2011 Sep;458−464. PMID: 23493061.PubMed
  • 25. Pereira A.S., Andrade S.S., Monteiro J.. Evaluation of the susceptibility profiles, genetic similarity and presence of qnr gene in Escherichia coli resistant to ciprofloxacin isolated in Brazilian hospitals. Braz J Infect Dis 11(1). 2007 Feb;40−43. PMID: 17625725.ArticlePubMed
  • 26. Deepak R.N., Koh T.H., Chan K.S.. Plasmid-mediated quinolone resistance determinants in urinary isolates of Escherichia coli and Klebsiella pneumoniae in a large Singapore hospital. Ann Acad Med Singapore 38(12). 2009 Dec;1070−1073. PMID: 20052442.ArticlePubMed
  • 27. Cavaco L.M., Hansen D.S., Friis-Møller A.. First detection of plasmid-mediated quinolone resistance (qnrA and qnrS) in Escherichia coli strains isolated from humans in Scandinavia. J Antimicrob Chemother 59(4). 2007 Apr;804−805. PMID: 17284539.ArticlePubMed
  • 28. Poirel L., Leviandier C., Nordmann P.. Prevalence and genetic analysis of plasmid-mediated quinolone resistance determinants QnrA and QnrS in Enterobacteriaceae isolates from a French university hospital. Antimicrob Agents Chemother 50(12). 2006 Dec;3992−3997. PMID: 16982792.ArticlePubMed
  • 29. Pitout J.D., Hanson N.D., Church D.L.. Population-based laboratory surveillance for Escherichia coli-producing extended-spectrum beta-lactamases: importance of community isolates with blaCTX-M genes. Clin Infect Dis 38(12). 2004 Jun 15;1736−1741. PMID: 15227620.
  • 30. Hassan W., Hashim A., Domany R.. Plasmid mediated quinolone resistance determinants qnr, aac(6′)-Ib-cr, and qep in ESBL-producing Escherichia coli clinical isolates from Egypt. Indian J Med Microbiol 30(4). 2012 Oct-Dec;442−447. PMID: 23183470.ArticlePubMed
  • 31. Peymani A., Naserpour Farivar T., Nikooei L.. Emergence of plasmid-mediated quinolone-resistant determinants in Klebsiella pneumoniae isolates from Tehran and Qazvin provinces, Iran. J Prev Med Hyg 56(2). 2015 Aug 5;E61−E65. PMID: 26789990.
Figure 1
Enterobacterial repetitive intergenic consensus-profiles of four qnr-positive Escherichia coli isolated from Qazvin and Zanjan hospitals. Lane 1 = 100-bp DNA ladder, Lanes 2 and 4 = EC 36 and EC 76 (Qazvin hospitals); Lanes 3 and 5 = EC 75 and EC 127 (Zanjan hospital).
gr1
Table 1
Primers used for detection of qnr genes in urinary Escherichia coli isolates.
qnr genes Sequence (5'→3′) Annealing temperatures (°C) References
qnrA1–6 ACG CCAGGATTTGAGTGAC
CCAGGCACAGATCTTGAC
53 [17]
qnrB1–3, 5, 6, 8 GGCACTGAATTT ATCGGC
TCCGAATTGGTCAGATCG
49 [17]
qnrB4 AGTTGTGATCTCTCCATGGC
CGGATATCTAAATCGCCCAG
53 [17]
qnrS1–2 CCTACAATCATACAT ATCGGC
GCTTCGAGAATCAGTTCTTGC
53 [17]
Table 2
Antimicrobial susceptibility of Escherichia coli isolates against carbapenem and quinolone compounds.
Antibiotics S
n (%)
I
n (%)
R
n (%)
Nalidixic acid 65 (32.5) 2 (1) 133 (66.5)
Gatifloxacin 84 (42) 116 (58)
Levofloxacin 85 (42.5) 3 (1.5) 112 (56)
Ciprofloxacin 88 (44) 112 (56)
Norfloxacin 89 (44.5) 111 (55.5)
Imipenem 182 (91) 16 (8) 2 (1)
Meropenem 186 (93) 12 (6) 2 (1)

I = intermediate; R = resistant; S = susceptible.

Table 3
Case history and characteristics of the four qnrS1-positive Escherichia coli isolates collected from Qazvin and Zanjan hospitals.
Isolates City Age (y)/sex Ward Resistance level to fluoroquinolone Antibiotic-susceptibility profile ERIC profile
EC 36 Qazvin 32/Female Internal High NA = R, CIP = R, LEV = R, NOR = R, GAT = R, IMP = S, MEM = S A
EC 75 Zanjan 70/Female Intensive care unit High NA = R, CIP = R, LEV = R, NOR = R, GAT = R, IMP = S, MEM = S B
EC 76 Qazvin 42/Male Internal Low NA = R, CIP = S, LEV = S, NOR = S, GAT = S, IMP = S, MEM = S C
EC 127 Zanjan 59/Female Internal High NA = R, CIP = S, LEV = S, NOR = S, GAT = S, IMP = R, MEM = R B

CIP = ciprofloxacin; ERIC = enterobacterial repetitive intergenic consensus; GAT = gatifloxacin; IMP = imipenem; LEV = levofloxacin; MEM = meropenem; NA = nalidixic acid; R = resistant; S = susceptible.

Figure & Data

References

    Citations

    Citations to this article as recorded by  
    • Polluted surface water is a repository of antibiotic-resistant Escherichia coli harbouring Plasmid-Mediated Quinolone Resistance (PMQR) determinants
      Abimbola Olumide Adekanmbi, Victoria Oluwanifemi Odunfa, Olabisi Comfort Akinlabi, Adedolapo Victoria Olaposi, Oreoluwa Samuel Adebowale, Zaccheaus Oluwaseun Faniran, Omowunmi Abosede Banjo
      International Journal of Environmental Studies.2024; 81(2): 629.     CrossRef
    • Phylogenetic analysis, biofilm formation, antimicrobial resistance and relationship between these characteristics in Uropathogenic Escherichia coli
      Talieh Mostaghimi, Abazar Pournajaf, Ali Bijani, Mohsen Mohammadi, Mehdi Rajabnia, Mehrdad Halaji
      Molecular Biology Reports.2024;[Epub]     CrossRef
    • A review of the mechanisms that confer antibiotic resistance in pathotypes of E. coli
      Sina Nasrollahian, Jay P. Graham, Mehrdad Halaji
      Frontiers in Cellular and Infection Microbiology.2024;[Epub]     CrossRef
    • Navigating fluoroquinolone resistance in Gram-negative bacteria: a comprehensive evaluation
      Linda Kherroubi, Joanna Bacon, Khondaker Miraz Rahman
      JAC-Antimicrobial Resistance.2024;[Epub]     CrossRef
    • Panel of primers for evaluation of antibiotic resistance genes with real time detection of results
      A. S. Mokhov, A. D. Klimova, D. V. Azarov, A. E. Goncharov
      Russian Journal for Personalized Medicine.2023; 3(1): 72.     CrossRef
    • Antimicrobial resistance in bacteria isolated from peridomestic Rattus species: A scoping literature review
      Theethawat Uea-Anuwong, Kaylee A. Byers, Lloyd Christian Wahl, Omid Nekouei, Yrjo Tapio Grohn, Ioannis Magouras
      One Health.2023; 16: 100522.     CrossRef
    • Prevalence and mechanisms of ciprofloxacin resistance in Escherichia coli isolated from hospitalized patients, healthy carriers, and wastewaters in Iran
      Zohreh Neyestani, Farzad Khademi, Roghayeh Teimourpour, Mojtaba Amani, Mohsen Arzanlou
      BMC Microbiology.2023;[Epub]     CrossRef
    • Quinolone resistance and biofilm formation capability of uropathogenic Escherichia coli isolates from an Iranian inpatients’ population
      Elham Rastegar, Yalda Malekzadegan, Reza Khashei, Nahal Hadi
      Molecular Biology Reports.2023; 50(10): 8073.     CrossRef
    • Antibiotic-resistant Escherichia coli Undergoes a Change in mcr-1 and qnr-S Expression after being Exposed to Gamma Irradiation
      Ahmed G. Merdash, Gamal M. El-Sherbiny, Ahmed O. El-Gendy, Ahmed F. Azmy, Hussein M. El-Kabbany, Maged S. Ahmad
      Journal of Pure and Applied Microbiology.2023; 17(4): 2620.     CrossRef
    • Frequency of Plasmid-Located Quinolone Resistance Genes in Clinical Isolates of Klebsiella pneumoniae in Northern Iran
      Leila Asadpour, Mohammad Moradi Bazghaleh
      Medical Laboratory Journal.2023; 17(3): 32.     CrossRef
    • Effect of ciprofloxacin and in vitro gut conditions on biofilm of Escherichia coli isolated from clinical and environmental sources
      Vankadari Aditya, Akshatha Kotian, Sreya Saikrishnan, Anusha Rohit, Divyashree Mithoor, Indrani Karunasagar, Vijaya Kumar Deekshit
      Journal of Applied Microbiology.2022; 132(2): 964.     CrossRef
    • Detection of qnrA, qnrB, and qnrS genes in Klebsiella pneumoniae and Escherichia coli isolates from leukemia patients
      Mahdane Roshani, Alireza Goodarzi, Ali Hashemi, Farhad Afrasiabi, Hossein Goudarzi, Mohammadreza Arabestani
      Reviews in Medical Microbiology.2022; 33(1): 14.     CrossRef
    • Decentralized systems for the treatment of antimicrobial compounds released from hospital aquatic wastes
      Manisha Sharma, Ankush Yadav, Kashyap Kumar Dubey, Joshua Tipple, Diganta Bhusan Das
      Science of The Total Environment.2022; 840: 156569.     CrossRef
    • Presence and Transfer of Antimicrobial Resistance Determinants in Escherichia coli in Pigs, Pork, and Humans in Thailand and Lao PDR Border Provinces
      Chanika Pungpian, Nuananong Sinwat, Sunpetch Angkititrakul, Rangsiya Prathan, Rungtip Chuanchuen
      Microbial Drug Resistance.2021; 27(4): 571.     CrossRef
    • Symptoms, risk factors, diagnosis and treatment of urinary tract infections
      Rajanbir Kaur, Rajinder Kaur
      Postgraduate Medical Journal.2021; 97(1154): 803.     CrossRef
    • Quinolone resistance (qnrA) gene in isolates of Escherichia coli collected from the Al-Hillah River in Babylon Province, Iraq
      Hawraa Mohammed Al-Rafyai, Mourouge Saadi Alwash, Noor Salman Al-Khafaji
      Pharmacia.2021; 68(1): 1.     CrossRef
    • Hypervirulent and hypermucoviscous extended-spectrum β-lactamase-producing Klebsiella pneumoniae and Klebsiella variicola in Chile
      F. Morales-León, A. Opazo-Capurro, C. Caro, N. Lincopan, A. Cardenas-Arias, F. Esposito, V. Illesca, M. L. Rioseco, M. Domínguez-Yévenes, C. A. Lima, H. Bello-Toledo, Gerardo González-Rocha
      Virulence.2021; 12(1): 35.     CrossRef
    • Surgical Antibiotic Prophylaxis in an Era of Antibiotic Resistance: Common Resistant Bacteria and Wider Considerations for Practice
      Bradley D Menz, Esmita Charani, David L Gordon, Andrew JM Leather, S Ramani Moonesinghe, Cameron J Phillips
      Infection and Drug Resistance.2021; Volume 14: 5235.     CrossRef
    • High prevalence of plasmid-mediated quinolone resistance (PMQR) among E. coli from aquatic environments in Bangladesh
      Mohammed Badrul Amin, Sumita Rani Saha, Md Rayhanul Islam, S. M. Arefeen Haider, Muhammed Iqbal Hossain, A. S. M. Homaun Kabir Chowdhury, Emily K. Rousham, Mohammad Aminul Islam, Abdelazeem Mohamed Algammal
      PLOS ONE.2021; 16(12): e0261970.     CrossRef
    • Development of quinolone resistance and prevalence of different virulence genes among Shigella flexneri and Shigella dysenteriae in environmental water samples
      B. Roy, S.K. Tousif Ahamed, B. Bandyopadhyay, N. Giri
      Letters in Applied Microbiology.2020; 71(1): 86.     CrossRef
    • Synergistic Activity of Fluoroquinolones Combining with Artesunate Against Multidrug-Resistant Escherichia coli
      SiMin Wei, YueFei Yang, Wei Tian, MingJiang Liu, ShaoJie Yin, JinGui Li
      Microbial Drug Resistance.2020; 26(1): 81.     CrossRef
    • Plasmid-Mediated Quinolone Resistance in Pseudomonas aeruginosa Isolated from Burn Patients in Tehran, Iran
      Azam Molapour, Amir Peymani, Parvaneh Saffarain, Narges Habibollah-Pourzereshki, Pooya Rashvand
      Infectious Disorders - Drug Targets .2020; 20(1): 49.     CrossRef
    • Plasmidic Fluoroquinolone Resistance Genes in Fluoroquinolone-Resistant and/or Extended Spectrum Beta-Lactamase-ProducingEscherichia coliStrains Isolated from Pediatric and Adult Patients Diagnosed with Urinary Tract Infection
      Melisa Akgoz, Irem Akman, Asuman Begum Ates, Cem Celik, Betul Keskin, Busra Betul Ozmen Capin, Zeynep Ceren Karahan
      Microbial Drug Resistance.2020; 26(11): 1334.     CrossRef
    • Characterization of Plasmid-Mediated Quinolone Resistance and Serogroup Distributions of Uropathogenic Escherichia coli among Iranian Kidney Transplant Patients
      Amin Sadeghi, Mehrdad Halaji, Amirhossein Fayyazi, Seyed Asghar Havaei, Yun Peng Chao
      BioMed Research International.2020; 2020: 1.     CrossRef
    • Antimicrobial resistance in fecal Escherichia coli isolated from poultry chicks in northern Iran
      Zohreh Pourhossein, Leila Asadpour, Hadi Habibollahi, Seyedeh Tooba Shafighi
      Gene Reports.2020; 21: 100926.     CrossRef
    • Determination of antibiotic resistance genes and virulence factors in Escherichia coli isolated from Turkish patients with urinary tract infection
      Azer Özad Düzgün, Funda Okumuş, Ayşegül Saral, Ayşegül Çopur Çiçek, Sedanur Cinemre
      Revista da Sociedade Brasileira de Medicina Tropic.2019;[Epub]     CrossRef
    • The emergence of antimicrobial resistance in environmental strains of the Bacteroides fragilis group
      Sebastian Niestępski, Monika Harnisz, Ewa Korzeniewska, Ma. Guadalupe Aguilera-Arreola, Araceli Contreras-Rodríguez, Zofia Filipkowska, Adriana Osińska
      Environment International.2019; 124: 408.     CrossRef
    • Evaluation of Quinolone Resistance in Escherichia coli Isolates Recovered from Urine and Feces of Patients with Acute or Recurrent Urinary Tract Infection
      Hossein Norouzian, Nader Shahrokhi, Shahram Sabeti, Saeid Bouzari, Mohammad Pooya
      Journal of Medical Microbiology and Infectious Dis.2019; 7(4): 120.     CrossRef
    • Plasmid-mediated quinolones resistance in clinically important bacteria
      M. Omidvar Panah, M. Najafi, A. Peymani
      The Journal of Qazvin University of Medical Scien.2018; 22(2): 90.     CrossRef
    • Detection of Plasmid-Mediated qnr Genes Among the Clinical Quinolone-Resistant Escherichia coli Strains Isolated in Tehran, Iran
      Reza Ranjbar, Sajjad S. Tolon, Mehrdad Sami, Reza Golmohammadi
      The Open Microbiology Journal.2018; 12(1): 248.     CrossRef
    • Characterization of Escherichia coli strains isolated from raw vegetables
      Pavel Pleva, Magda Janalí­ková, Silvie Pavlí­čková, Martin Lecomte, Tanguy Godillon, Ivan Holko
      Potravinarstvo Slovak Journal of Food Sciences.2018; 12(1): 304.     CrossRef

    • PubReader PubReader
    • Cite
      Cite
      export Copy
      Close
    • XML DownloadXML Download
    Figure
    • 0
    Plasmid-Mediated Quinolone-Resistance (qnr) Genes in Clinical Isolates of Escherichia coli Collected from Several Hospitals of Qazvin and Zanjan Provinces, Iran
    Image
    Figure 1 Enterobacterial repetitive intergenic consensus-profiles of four qnr-positive Escherichia coli isolated from Qazvin and Zanjan hospitals. Lane 1 = 100-bp DNA ladder, Lanes 2 and 4 = EC 36 and EC 76 (Qazvin hospitals); Lanes 3 and 5 = EC 75 and EC 127 (Zanjan hospital).
    Plasmid-Mediated Quinolone-Resistance (qnr) Genes in Clinical Isolates of Escherichia coli Collected from Several Hospitals of Qazvin and Zanjan Provinces, Iran
    Table 1
    qnr genesSequence (5'→3′)Annealing temperatures (°C)References
    qnrA1–6ACG CCAGGATTTGAGTGAC
    CCAGGCACAGATCTTGAC
    53[17]
    qnrB1–3, 5, 6, 8GGCACTGAATTT ATCGGC
    TCCGAATTGGTCAGATCG
    49[17]
    qnrB4AGTTGTGATCTCTCCATGGC
    CGGATATCTAAATCGCCCAG
    53[17]
    qnrS1–2CCTACAATCATACAT ATCGGC
    GCTTCGAGAATCAGTTCTTGC
    53[17]
    Table 2
    AntibioticsS
    n (%)
    I
    n (%)
    R
    n (%)
    Nalidixic acid65 (32.5)2 (1)133 (66.5)
    Gatifloxacin84 (42)116 (58)
    Levofloxacin85 (42.5)3 (1.5)112 (56)
    Ciprofloxacin88 (44)112 (56)
    Norfloxacin89 (44.5)111 (55.5)
    Imipenem182 (91)16 (8)2 (1)
    Meropenem186 (93)12 (6)2 (1)
    Table 3
    IsolatesCityAge (y)/sexWardResistance level to fluoroquinoloneAntibiotic-susceptibility profileERIC profile
    EC 36Qazvin32/FemaleInternalHighNA = R, CIP = R, LEV = R, NOR = R, GAT = R, IMP = S, MEM = SA
    EC 75Zanjan70/FemaleIntensive care unitHighNA = R, CIP = R, LEV = R, NOR = R, GAT = R, IMP = S, MEM = SB
    EC 76Qazvin42/MaleInternalLowNA = R, CIP = S, LEV = S, NOR = S, GAT = S, IMP = S, MEM = SC
    EC 127Zanjan59/FemaleInternalHighNA = R, CIP = S, LEV = S, NOR = S, GAT = S, IMP = R, MEM = RB
    Table 1 Primers used for detection of qnr genes in urinary Escherichia coli isolates.

    Table 2 Antimicrobial susceptibility of Escherichia coli isolates against carbapenem and quinolone compounds.

    I = intermediate; R = resistant; S = susceptible.

    Table 3 Case history and characteristics of the four qnrS1-positive Escherichia coli isolates collected from Qazvin and Zanjan hospitals.

    CIP = ciprofloxacin; ERIC = enterobacterial repetitive intergenic consensus; GAT = gatifloxacin; IMP = imipenem; LEV = levofloxacin; MEM = meropenem; NA = nalidixic acid; R = resistant; S = susceptible.


    PHRP : Osong Public Health and Research Perspectives
    TOP